Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLPT-5-E3

SGN-M3036

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110510
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40470)
Chromosome
3
Position
74.10 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-E3 was used as an overgo probe on plate 8 [well H8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGCCTTGAAAAGACTCCTCCTTTG
B sequence
GAGAGAAGAAGGCATGCAAAGGAG
AB sequence
TGCCTTGAAAAGACTCCTCCTTTGCATGCC
Marker sequence
CTCCCAAACCCTAACTCTCTCCTTCATCAAGAATCTTCCAATCAAATCTC
TATCTTTGATTTTCTATCTTTTTCATATTTTTTTTGGTTACAGATTTCAT
TACATTTTCTTCAATCAGATTTCTGATTGATGAATCTTTCAAATCTGGTT
GAGATTTGGATGTTTGTTTCATTTGGATGATTTAAACGATGATTGCAGAT
CCGAATTTGGTTTACTACTCTTGTGTTGCCAAAGGAACAACTATCCTTGC
TGAGATCAATTCAAAAGATGCCGATCTTGGATCCCTAGCTTTGAAATGCC
TTGAAAAGACTCCTCCTTTGCATGCCTTCTTCTCTCATACTATCCGAAAC
AGGACATACACGTTCCTGATTGAAAACCCATATGTGTTTTTCGCCATATT
CGATGGAAAAATTGACAAATCAGATGGTCTTGCGTTTCTCAAAGGGGTTG
AAGAGGCGTT
Genomic location of cLPT-5-E3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3036 marker 3036
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)