SGN Marker cLEC-20-F13

SGN-M3037

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C3358
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40274)
Chromosome
3
Position
74.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-20-F13 was used as an overgo probe on plate 9 [well B2]

Plausible BAC Matches:   P269F06,   P159G17,   P138P06,   P057B01,   P171C06,   P163H12,   P088B11,   P025M16,   P197D06,   P334C01,   P254B14,   P069C22

 Overgo Sequences

A sequence
GGAGGCCTTGTTAAGACTGATTGG
B sequence
TAAAGGGTGCTTGGCTCCAATCAG
AB sequence
GGAGGCCTTGTTAAGACTGATTGGAGCCAA
Marker sequence
TACTTAACAATGGCGACCTCCTTACTCTCTCACTTGACAAAATCTCAGGC
TCTGGTTTTCAATCCAAGAATGAATATCTCTTTGGTAAAATTGACATGCA
GCTCAAACTTGTCCCAGGAAATTCTGCTGGCACTGTCACTGCTTACTATT
TGTCATCACAAGGACCAACACATGATGAGATAGATTTTGAATTCTTGGGA
AATTTAAGTGGTGATCCTTATACTCTCCATACTAATGTATTTAGTCAAGG
CAAAGGAAACAGAGAACAACAATTTCATCTCTGGTTTGACCCTACTGCTG
ATTTCCACACGTATTCCATCACTTGGAATCCACAACGCATCATATTTTAT
GTGGACGGAACGCCAATTAGAGAATACAAGAATAGTGAATCGATTGGAGT
TTCATATCCAAAGAACCAACCCATGAGGATATATTCGAGTCTTTGGAATG
CTGATGATTGGGCTACAAGAGGAGGCCTTGTTAAGACTGATTGGAGCCAA
GCACCCTTTAGTGCTTCTTACAGAAACTTCAGTGCTAATGCTTGCATTCC
CACTTCTTCATCTTCTTGCAGTTCCAATTCTGCAGCTTCAACAAGCAATT
CATGGTTGAATGAAGAGTTAGATAACACAGGCCAAGAGAAGCTCAAATGG
GTGCAGAAAAATTACATGGGTTATGATTACTGCACTGATTCAAAGCGATT
TCC
Genomic location of cLEC-20-F13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3037 marker 3037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)