Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1938

SGN-M3041
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39796)
Chromosome
3
Position
93.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1938 was used as an overgo probe on plate 6 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTGGATAGATTCTGGTGCCTCAT
B sequence
TTGGCACAAACATGGCATGAGGCA
AB sequence
GGTGGATAGATTCTGGTGCCTCATGCCATG
Marker sequence
GAAATTCATTGTGGCAAAATTTCTAGACTTTAAGATGATAGACAGTAAGA
CTGTCGTCACCCAAGTTCAAGAATTGCAGGTTATAATCCATGATCTCCTT
GCTGAAGGATTGATTGTGAATGATGCTTTTCAAGTGGCTGCAATTATTGA
AAAGTTACCTCTATTGTGGAAGGACTTTAAAAACTACTTGAAACACAAAC
GCAAGGAGATGATTGTTGAAGATCTCATAGTAAGGTTGAGAATCGAAGAG
GATAATAAGGCTGCAGAAAAGAGGTCACGTGGTAATTCAGCAATATCTGG
AGTAAATTTTGTTGAAGAAGATTCCACAAAATTCAAGAAAAGAAAGAAAG
CATCTGGTCCAAAACGCAATCCTCCTAAGAAGAAATTCAATGGAAACTGC
TTTAATTGTGGTAAACATGGTCATAGGGCTAATGAATGCCGGGGTCCTAA
GAAGGACAAGAAAAAGAAGGATCAAGCAAACTTGGCTGAATCCAAAGGAG
AAATGGACGATCTCTGTGCAATGCTTTCAGAATGTAACTTGGTTGGAAAT
CCAAGAGAATGGTGGATAGATTCTGGTGCCTCATGCCATGTTTGTGCCAA
CAAAGAATTATTTTCATCATATACT
Genomic location of T1938  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3041 marker 3041
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)