SGN Marker cLET-21-N18

SGN-M3042

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82825
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51088)
Chromosome
3
Position
56.78 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49024)
Chromosome
3
Position
74.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40372)
Chromosome
3
Position
94.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-21-N18 was used as an overgo probe on plate 6 [well E9]

Plausible BAC Matches:   P127A06,   P171A15,   P181M08,   P109P14,   P046E04

 Overgo Sequences

A sequence
CCCAATTCTCTCCTACGTCATGTC
B sequence
CATACTGGGTAGCTTGGACATGAC
AB sequence
CCCAATTCTCTCCTACGTCATGTCCAAGCT
Marker sequence
CAACCGCTTTTCCCAATTTCACTTGATAATCTCCAGTAGCCATGGATCCG
AACCCTACCAAATTCCCAATTCTCTCCTACGTCATGTCCAAGCTACCCAG
TATGGGCCGTAGAACCACCGCCACCGCCGATGAATTCGACATCGAACAGC
CACAGAACCACCCTCAGCCTCCTCCAGAACCACACTTCGACATTACCGAG
CGTATGCCTCATCTCACTGACCCTAAGGTTGTCAGCGCTATGCGATCAGC
CGTTGCTGACGTGTCACAGACCCGGTCAATGCTCAAAACCCTGGGTGAGC
GGCCTTTTCACGAGCTTGTTGATACTGCCAGGGTGAAGTTAGCTGAGATC
GATGCCGATATGTCCAAGCGTCTTGAGGAGATTG
Genomic location of cLET-21-N18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3042 marker 3042
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)