SGN Marker cLED-19-N16

SGN-M3043

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C17487
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40303)
Chromosome
3
Position
107.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-19-N16 was used as an overgo probe on plate 2 [well G10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTCATGAGATCTCTGTGCTTTGC
B sequence
GTCCAACTTCAGCATCGCAAAGCA
AB sequence
GCTCATGAGATCTCTGTGCTTTGCGATGCT
Marker sequence
AATTTATCATTTGCCAAAAACAAAGAATTACTAAACATAAATATCCATTT
CCATTACACAATATACATATATATACACACACAAAGAAGAAAGAAGAAAG
AAGAAATTAATATGGGTAGAGGAAGAGTACAATTGAAGAGAATTGAGAAC
AAAATTAATCGTCAAGTTACTTTTTCAAAGAGGCGATCTGGTTTGCTTAA
AAAAGCTCATGAGATCTCTGTGCTTTGCGATGCTGAAGTTGGACTCATTG
TTTTCTCAACTAAAGGAAAACTCTTTGAGTATTCTACTGACTCTTGCATG
GAAAGGATTCTTGAAAGGTATGAAAGGTACTCATATGCTGAAAGGCAGCT
TAATGCTACTGATATTATAACCCCGGGTAGCTGGACTTTGGAACATGCTA
AGCTTAAGGCCAGACTTGAGGTTTTGCAAAGAAACCAAAAGCATTATGCA
GGAGAAGAGTTGGACACATTGAGTATGAAAGAGCTTCAGAATCTGGAACA
CCAGCTCGATTCTGCTCTTAAGCACATTCGATCTAGAAAGAACCAATTGA
TGCATGAATCCATTCTGAGCTTAAAAGAAGG
Genomic location of cLED-19-N16  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3043 marker 3043
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)