SGN Marker cLEC-7-F22

SGN-M3044

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14259
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40285)
Chromosome
3
Position
115.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-7-F22 was used as an overgo probe on plate 2 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGTGTGTTTGGACAAGAAAGCTGG
B sequence
CAAAGCAGCCAATGAGCCAGCTTT
AB sequence
CGTGTGTTTGGACAAGAAAGCTGGCTCATT
Marker sequence
TTGACTTAGAGAAACAATTTGCATTCTATGGAGCTTACCATAGCAACCCA
GTGAATGTATTGATTCACATGGTGTTTGTGTGGCCTATCGTGTTCACTGC
TCTTATTCTTTTCGAATTTACGCCCTCACTTTTCAATTTACCTCCGATTC
AGCTTTGTGAGCACAGTTCATTGGTCCTTAATTATGGGTTTTTGCTTACT
TTGGGGTATGCACTGTTCTACGTGTGTTTGGACAAGAAAGCTGGCTCATT
GGCTGCTTTGCTATGTTTCATTTGTTGGGTTTCCAGTGGTATGGTTGCTC
GTCAATTGGGGTTCTCTCTCGCCTGGAAGGTTGTTCTAGCGGCTCAATTG
TTCTGCTGGACTGGACAGTTTATAGGTCATGGAGTGTTTGAGAAGCGAGC
ACCTGCCCTTCTGGACAATCTTGCACAAGCTTTCCTTATGGCACCGTTCT
TTGTTCTCCTTGAGGCCCTCCAATCTCTTTTTGGCTATGAACCATACCCT
GGGGTTTCATTCAAAAGTGAAAGCAACAATTGATGCTGAAATCAAAGAAT
GGCAGGAGAAGAAAC
Genomic location of cLEC-7-F22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3044 marker 3044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)