Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1935

SGN-M3046
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39794)
Chromosome
3
Position
130.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1935 was used as an overgo probe on plate 6 [well D6]

Plausible BAC Matches:   P320E06,   P031F10,   P304N04,   P042A09

 Overgo Sequences

A sequence
GGTGCTTTGCTTGGATGAATGCAC
B sequence
AGTGTCCACATTTGCCGTGCATTC
AB sequence
GGTGCTTTGCTTGGATGAATGCACGGCAAA
Marker sequence
GCACGAGGGAACAGCATTTTCTGTTGGTCAAAAGCAGCTACTCTGCCTAG
CACGTGCTCTCCTCAAGTCCTGCAAGGTGCTTTGCTTGGATGAATGCACG
GCAAATGTGGACACTGAAACAACTTCAAAACTACAGAAAACTCTAGCCAC
CGAATGCCATGGAACAACGGTTATCACAATTGCCCATCGCATTTCAACAG
TTATGAGTATGGACAATATCCTGATTTTGGATCGAGGGTTCCTGGTAAAC
GTACTTTCTTGACAAGCTTCCCTTCGTTTAAACTGTCTAGACATAAGAAT
TGAATCATAAGAATATAACAAAAGTAGCTGGTTGCTTTGACATTTTTTAA
GTCTCTTCGGGCTAATTATTTACTATTATACTTATC
Genomic location of T1935  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3046 marker 3046
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)