SGN Marker cLEC-9-H23

SGN-M3048

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14888
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40290)
Chromosome
3
Position
171.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40291)
Chromosome
6
Position
43.30 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-9-H23 was used as an overgo probe on plate 16 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAAATCCTCAAGCACTTGCTCAG
B sequence
AGAAAGTGATAGGCTGCTGAGCAA
AB sequence
GGAAATCCTCAAGCACTTGCTCAGCAGCCT
Marker sequence
ATTCTCCATCACTTTCTCCTAATTCTCCATTAAATTCTCTTCTTCGTTTC
TTCTCCGCTCTTCCTGCTTATTCTCCTGATTCAATGGCTTCAGATTATTC
AGCAACTCACATCACTGTTGATAATATTAATCCAAAGGTTTTGAAATGTG
AGTATGCTGTTCGTGGAGAGATTGTATCAATTGCTCAGACATTGCAGCAA
AGGCTCAAGGATAATCCAGGTTCTCATCCTTTTGATGAGATCTTATATTG
CAATATTGGAAATCCTCAAGCACTTGCTCAGCAGCCTATCACTTTCTTTA
GAGAGGTCCTTGCGTTATGTGATCATCCATCCATTTTGGACAAAAGTGAA
ACACAAGGGTCTATTC

cLEC-9-H23 was used as an overgo probe on plate 5 [well B4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGAAATCCTCAAGCACTTGCTCAG
B sequence
AGAAAGTGATAGGCTGCTGAGCAA
AB sequence
GGAAATCCTCAAGCACTTGCTCAGCAGCCT
Marker sequence
ATTCTCCATCACTTTCTCCTAATTCTCCATTAAATTCTCTTCTTCGTTTC
TTCTCCGCTCTTCCTGCTTATTCTCCTGATTCAATGGCTTCAGATTATTC
AGCAACTCACATCACTGTTGATAATATTAATCCAAAGGTTTTGAAATGTG
AGTATGCTGTTCGTGGAGAGATTGTATCAATTGCTCAGACATTGCAGCAA
AGGCTCAAGGATAATCCAGGTTCTCATCCTTTTGATGAGATCTTATATTG
CAATATTGGAAATCCTCAAGCACTTGCTCAGCAGCCTATCACTTTCTTTA
GAGAGGTCCTTGCGTTATGTGATCATCCATCCATTTTGGACAAAAGTGAA
ACACAAGGGTCTATTC
Genomic location of cLEC-9-H23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3048 marker 3048
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)