SGN Marker TG607

SGN-M305

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GAGACACGCTTGCATGCCTGCAGTATCTGGTGTTAGAAAAGGTATTACAGCTGACTTTGTCAGATGCCTTGGAAGAAATATTGCCAAATT
TTAGAATATCTTACAGGGATTTTATGCAGATACAGACACATGCCCAGATCATTGGAGAACTCATTCTGCCTTTGCTGGAAATCCTGATTT
ACTCAACATTACAAGCTTAAGACCATCAGTATCTAGATCTGTCATAAAAGAGACACTTCAATGCTTTGGCAAGGTAAAACATTTCAGTCT
AAAAAGCAGAACTTAAGGAAATGGAGGGTGGGGAAGTACCTTTCTTTTTTCTTTCCTAGAATTTCTTATCAAATTTGTTTCACATTGTTT
TCTTTTCCTTTTACCTCAATTGCAGACGTTAAACATACCTAATGTTCAGAGAGACAGGTCAGTACTTTCTGATCTTCTGGAGGCATTCCA
GCCAATCAGCATTTCAGACTGCTTTTTCCAAGGCATGCAATTGATTCCATCACCAGGAGATATAGGTTATTTATATGCTG
Reverse sequence
GGAGACACCTTGCATGCCTGCAGTATCTGGTGTTAGAAAAGGTATTACAGCTGACTTTGTCAGATGCCTTGGAAGAAATATTGCCAAATT
TTAGAATATCTTACAGGGATTTTATGCAGATACAGACACATGCCCAGATCATTGGAGAACTCATTCTGCCTTTGCTGGAAATCCTGATTT
ACTCAACATTACAAGCTTAAGACCATCAGTATCTAGATCTGTCATAAAAGAGACACTTCAATGCTTTGGCAAGGTAAAACATTTCAGTCT
AAAAAGCAGAACTTAAGGAAATGGAGGGTGGGGAAGTACCTTTCTTTTTTCTTTCCTAGAATTTCTTATCAAATTTGTTTCTCATTGTTT
TCTTTTCCTTTTACCTCAATTGCAGACGTTAAACATACCTAATGTTCAGAGAGACAGGTCAGTACTTTCTGATCTTCTGGAGGCATTCCA
GCCAATCAGCATTTCAGACTGCTTTTTCCAAGGCATGCAATTGATTCCATCACCAGGAGATATAGGTTATTTATATGCTGGTGCATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42494)
Chromosome
1
Position
100.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40111)
Chromosome
1
Position
96.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8846)
Chromosome
1
Position
116.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8845)
Chromosome
1
Position
73.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG607 was used as an overgo probe on plate 3 [well B11]

Plausible BAC Matches:   P320C14,   P174N24,   P126H21,   P155N10,   P142L10,   P317I06

 Overgo Sequences

A sequence
CATGCCCAGATCATTGGAGAACTC
B sequence
CCAGCAAAGGCAGAATGAGTTCTC
AB sequence
CATGCCCAGATCATTGGAGAACTCATTCTG
Marker sequence
GAGACACGCTTGCATGCCTGCAGTATCTGGTGTTAGAAAAGGTATTACAG
CTGACTTTGTCAGATGCCTTGGAAGAAATATTGCCAAATTTTAGAATATC
TTACAGGGATTTTATGCAGATACAGACACATGCCCAGATCATTGGAGAAC
TCATTCTGCCTTTGCTGGAAATCCTGATTTACTCAACATTACAAGCTTAA
GACCATCAGTATCTAGATCTGTCATAAAAGAGACACTTCAATGCTTTGGC
AAGGTAAAACATTTCAGTCTAAAAAGCAGAACTTAAGGAAATGGAGGGT
Genomic location of TG607  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D305 marker 305
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)