SGN Marker cLED-7-G23

SGN-M3055

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C24171
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40309)
Chromosome
4
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-7-G23 was used as an overgo probe on plate 8 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCGTGTGGTTTGTCATACGTATGC
B sequence
AGTCGCTGAGCAAGAAGCATACGT
AB sequence
GCGTGTGGTTTGTCATACGTATGCTTCTTG
Marker sequence
CGACTTCTCCAGAACCTTTGAGAAAGCCCTCACGCCGCTTGTTCATCTTG
TCCAAATCTCGGCATTCTCTTTCTATACATAAAGATTTTCAATGGCGGCG
AGAATCGCATTGCTGAAGTACCTGAGAGTGGAAGCTCGGCCAGTGCAGCT
TCGAAACCCTAGGCTCATCGGAGGTTCAGTTAGTCAGCTTTTCAAACGTC
ATTTCTCAGAGGAAGTAAGGGGATCGTTTCTCGACAAGGATGAAGTTAGG
GATCGTGTTATCAACGTCGTCAAAAACTTTCAGAAAGTTGATCCTTGCAA
GGTTGTCCCAAATGCTCACTTCCAAAATGATCTTGGGTTAGATAGTTTAG
ACACTGTGGAAGTTGTGATGGCCCTTGAAGAAGAATTTGGGTTTGAGATT
CCAGACAATGAAGCCGACAAGATCAACTCAATAAACTTAGCAGTTGATTT
CATTGCATCTCACCCTCAGGCAAAATAAGCGAACAAAATATAGCTTGATG
AGTACTCATTTCCTTTTATAACTTCTTTGTCCCAATTCAACTACTTCATT
TACTCACTTTTGGCGTGTGGTTTGTCATACGTATGCTTCTTGCTCAGCGA
CTTGT
Genomic location of cLED-7-G23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3055 marker 3055
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)