Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker TG461

SGN-M306

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GAGACATCTTGCATGCCTGCAGTTCTTAGGATAATTGTCGAGAGCAACATTCTTTACAGCTCCTTCTTTTGCTATGTATACTTCTTATAA
AAGAGGCAGCCCTGTGCACAAAACATCCTGCATTAGCTGGGTCAGGGGAAGGGTCGCAACCTAACACATAAGCATACATATTTGTTTCGT
TATCTGTTAATTATGTTGTGAACACCAGTATATATCTCTAACACATTTCTGTAACTGTAAACACGAGCTCTATTGAATGACCTATCCTAG
TGGAATCCCCGATGCGTCACTGGATCCAATAAATTTGCTTCATTAATTTGG
Reverse sequence
GCCATAGCAGCGAAGTCATTAATAATTGGAGAGACGGTATATATCGAATATCAACTTGGCTGGACGTATTGATGTCAGCAACAACCAACT
AAACAAAATATTTCCATTTGCTTCAACAAATATGGCAAGAAAGAGTGACAGATCATCTCGAAATTGTTTGGCTTGATGTAGGAAAATAGA
AGAAAAAAAAAGAAAAGAACAGATCTTCAAATGGAAGATGGGAGAAACTTTCCTTCTTTCCCTTCTTTTTCCTTTTCAAAGCAAGGATTA
TTTCCGCATAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8849)
Chromosome
1
Position
126.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG461 was used as an overgo probe on plate 3 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P027H09,   P244P19,   P016F24,   P116D10,   P284P18,   P263F23,   P093P14,   P027E04,   P291N17,   P218D18,   P116D09,   P291F14,   P026M21,   P023C20,   P123J13,   P008N02,   P003C18,   P167A22,   P135M11,   P052C07,   P098B16,   P046A06,   P169M15,   P263L12,   P254I24

 Overgo Sequences

A sequence
ACTGTAAACACGAGCTCTATTGAA
B sequence
CCACTAGGATAGGTCATTCAATAG
AB sequence
ACTGTAAACACGAGCTCTATTGAATGACCT
Marker sequence
AAGGGTCGCAACCTAACACATAAGCATACATATTTGTTTCGTTATCTGTT
AATTATGTTGTGAACACCAGTATATATCTCTAACACATTTCTGTAACTGT
AAACACGAGCTCTATTGAATGACCTATCCTAGTGGAAT
Genomic location of TG461  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D306 marker 306
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)