SGN Marker cLET-5-D13

SGN-M3072

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87578
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40397)
Chromosome
4
Position
132.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-D13 was used as an overgo probe on plate 7 [well B4]

Plausible BAC Matches:   P152B15

 Overgo Sequences

A sequence
ATGCCATGGCACTTGAAGTGTTGC
B sequence
CCATCATCACCACCAAGCAACACT
AB sequence
ATGCCATGGCACTTGAAGTGTTGCTTGGTG
Marker sequence
CAACTCCTACTCCCCTTTTCTTGATTCCAAATTTTCAATCACAAAAGCAA
CAACAAGAAGCATATTAATAAACAATGGCCACTGTTACCTCTGCTGCTGT
TGCTATTCCATCTTTCACTGGCCTTAAGGCTGGTGCTTCATCATCTTCCA
GAGTTAGCACCGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGA
TTGACTGTGAAGGCGTCTTTGAAAGATGTCGGTGCTGTGGTTGCTGCCAC
CGCTGTTAGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGC
TTGGTGGTGATGATGGGAGTCTAGCTTTTATTCCTGGAAACTTCAGCGTT
AGTGCTGGTGAGAAAATTACATTCAAGAACAATGCAGGGTTCCCACACAA
CGTCGTATTTGATGAAGATGAAATCCCAGCTGGTGTGGATGCTAGTAAGA
TTTCCATGTCTGAA
Genomic location of cLET-5-D13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3072 marker 3072
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)