SGN Marker cLPT-2-K6

SGN-M3074

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110160
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51120)
Chromosome
4
Position
63.62 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49055)
Chromosome
4
Position
126.44 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40463)
Chromosome
4
Position
135.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-2-K6 was used as an overgo probe on plate 6 [well F7]

Plausible BAC Matches:   P062F18,   P173K06,   P029B20,   P157C01,   P262O02,   P192C18,   P157C02,   P110O21

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCATGTGCAGCAGAGAGTTGGAAC
B sequence
GCCTCTGCTAGATTGAGTTCCAAC
AB sequence
TCATGTGCAGCAGAGAGTTGGAACTCAATC
Marker sequence
CATTAAGTGCATCTGTTGTGAAGCTTTTGAGGTGGTCCTTCAATGATGTT
ATGCATGCTTGTGCACAAGTTCAAAATTGTGATTTGGCTGAACAGTTGAT
GTTACAGATGCAAACTCTTGGTTTGCAACCATCAGGGAGTACATATGATG
GCTTCATTAGGGCAATTGCTACCACAAGAGGCTTTAGTGATGGAGTGGAA
GTGCTAAAGGTTATGAAAGAGAAAAATATTAAGCCTCATGATTCAACTCT
TGCTGTTTTAGCAGTCATGTGCAGCAGAGAGTTGGAACTCAATCTAGCAG
AGGCTTTCTTGGCTGAGATGTCCAAAATCCATAATCCTCGTCCTTATAAT
GCTTTTCTTGAAGCATGTGATGTTCTGGATCGGCCCGAACGAGCAGTCCA
GATATTGGCTAAGATGAAAAGGTTGAATCTTCAGCCAAATATCAGGACAT
ATGAGTTGCTATTCTCACTGTTTGGTAATGTAAATGCACCTTATGAAGAG
GGCAACATGCTGTCACAAGTGGATGTTGCTAAAAGGATAAATGCTATAGA
AATGGACATGATGAGGAATGGCATTCAGCACAGTCATCTGTCGTTGAGGA
ATGTGTTGAAAG
Genomic location of cLPT-2-K6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3074 marker 3074
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)