SGN Marker cLED-8-G3

SGN-M3078

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C24473
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40310)
Chromosome
5
Position
15.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-8-G3 was used as an overgo probe on plate 12 [well A4]

Plausible BAC Matches:   P232L14,   P060L24,   P179E24

 Overgo Sequences

A sequence
TCGAAGATGTTGGTCGAGGAGAAG
B sequence
GACCTCTCTTTAGACACTTCTCCT
AB sequence
TCGAAGATGTTGGTCGAGGAGAAGTGTCTA
Marker sequence
GCACGAGCTTATTTCCTCTTTCATCTACTTATGCATACTCATTTTCTTCA
CTCAATTTTTTAACTCTTTTTTTTTTCTTGGATAATGGCACTGACCCTTC
TTCATTCTCCCCTTAATTATCACATAAAAATTTTCCAAATTTCAAGATTC
AATCAAAAAACCCCATTTCCCACTGCTTAAACAAACCCCACATAGTTTTT
TTGTTTTCACAATTCTTGCACCTTAGAGAACTTAAGGGTTGAAAGTAAAA
TAAATATGGAAGTTGGAAGGGTTATTAATGAAAAACTTTCTCATTGTCTC
TGGATGTCCAATTCTTCCCCATCTTTTCATGGTTCTGTATCAATGGTTAA
TTTCGAAGATGTTGGTCGAGGAGAAGTGTCTAAAGAGAGGTCATTTTTCC
CAGGAATTGACAAAGAAGAAACTAGCAATGATGATTATGATAGCTGTTAT
CATCAGCCAGAGAAGAAGAGAAGACTTTTGCCTAATCAAGTTCATTTTCT
TGAGAAGAGTTTTGAGGTAGATAACAAGC
Genomic location of cLED-8-G3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3078 marker 3078
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)