SGN Marker cLET-7-N9

SGN-M3079

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88344
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51096)
Chromosome
5
Position
5.32 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49032)
Chromosome
5
Position
69.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40414)
Chromosome
5
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-7-N9 was used as an overgo probe on plate 11 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCATTAACGACACGGTCTCAGCA
B sequence
CTTCAGCAGCTTTCTCTGCTGAGA
AB sequence
TCCATTAACGACACGGTCTCAGCAGAGAAA
Marker sequence
CTTTTAGAGCAGTGTTATTTAACATCCTCTAAATAAGGATGGCTCTTTCT
GGGGCTAATAAAGATGGAAGAGAGGTGAGGATTTATGAGTATTTGGACGA
ACTGAACACCGATTTGGCAGATTATATCGCAGAATTATCAGAGGCTTCTG
TGAAGGAGAGGGGGGTATTTGCTATTGCTTTATCTGGTGGCTCCCTCATC
AGCTTGATGGGAAAACTGTGTGAAGCTCCTTATAGCAAAACTGTTGATTG
GGCTAAGTGGTATATATTTTGGGTGGACGAACGTGTGGTGGCGAAAAATC
ATGCTGACAGTAATTACAAGCTTGCCAAGGATGGACTTTTGTCCAAGGTG
CCTATTGTTCCAAGCCATGTACATTCCATTAACGACACGGTCTCAGCAGA
GAAAGCTGCTGAAGACTATGAGTTTGTTATTCGACAGCTTGTGAGAACTC
GTGTAATCAGCGTTTCTGACATCAGTGACTGCCCCAAAGTTGACCTCATC
CTTTTGGGAATGGGACC
Genomic location of cLET-7-N9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3079 marker 3079
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)