SGN Marker cLET-6-I4

SGN-M3081

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87976
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40407)
Chromosome
5
Position
70.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-6-I4 was used as an overgo probe on plate 12 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCTGAAGGATCTCCAGAAGGATC
B sequence
CTGCATGAAGTAGGAGGATCCTTC
AB sequence
AGCTGAAGGATCTCCAGAAGGATCCTCCTA
Marker sequence
GTTTCGCGTAAAGAGTCAGCAGCTTTTCCGATTTTCTGATCAGATTCAGA
TTTGTTTGGATTTTGATGGCTTCGAAACGAATATTGAAGGAGCTGAAGGA
TCTCCAGAAGGATCCTCCTACTTCATGCAGCGCTGGCCCTGTTGGAGAGG
ACATGTTTCACTGGCAGGCTACAATAATGGGGCCCTCTGATAGCCCTTAT
GCTGGGGGTGTTTTTTTGGTCACGATCCATTTTCCTCCGGATTATCCATT
CAAGCCTCCTAAGGTTGCTTTTAGGACAAAAGTTTTCCATCCAAATATCA
ATAGCAATGGGAGTATATGCTTGGACATACTGAAGGAGCAGTGGAGCCCT
GCATTAACTATTTCCAAGGTTTTGCTTTCAATTTGCTCACTTTTGACGGA
CCCAAACCCTGACGACCCCTTGGTTCCTGAGATTGCTCACATGTACAAGA
CTGACAAGTCCAAATACGAAGGAACCGCCAGGAGTTGGACCCAGAAGTAT
GCCATGGGTT
Genomic location of cLET-6-I4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3081 marker 3081
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)