SGN Marker cLEX-13-G5

SGN-M3083

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C93010
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40434)
Chromosome
5
Position
79.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35665
Forward primer (5'-3')
GCAGCATTTAGGCTCAGAGG
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 120+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCAGTGGATCGTGATGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 73
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 120+300
Solanum pennellii LA716: 420
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 420
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLEX-13-G5 was used as an overgo probe on plate 11 [well E11]

Plausible BAC Matches:   P334K22

 Overgo Sequences

A sequence
ATGCAGCCATGGCATATGACAGAG
B sequence
CTGAGCCTAAATGCTGCTCTGTCA
AB sequence
ATGCAGCCATGGCATATGACAGAGCAGCAT
Marker sequence
GAATTTGCAGCGGAGATTCGTGACCCAACTAGAAAGGGGACACGAGTTTG
GTTAGGAACATTCGATACTGCAATGGATGCAGCCATGGCATATGACAGAG
CAGCATTTAGGCTCAGAGGGAGTAAAGCAATCTTGAATTTTCCACTTGAG
GTAAGCAATTTCAAGCAAGAAAATCATGAGATTGAGAAAAATGTTGTGAA
TTTGAATTCGAATACGAATTCTTGTGGGAAAAGGGTGAGAGGGGAAATGG
AGAATGATGACGGAATTGTAATGAAGAAAGAGGTGAAAAGAGAACAAATG
GTGGCAACTCCATTAACACCTTCAAATTGGTCTTCAATTTGGGATTGTGG
AAATGGAAAAGGTATTTTTGAAGTGCCACCTTTGTCACCATTATCACCAC
ATTCAAATTTTGGTTATTCTCAACTTTTGGTATCATAGTGAAATCCCCAA
AAGAATCCACTTGAGTATGTTATGGAATATTATATAGCGGAACTATACTG
CCATCACGATCCACTGAGAATTAGTCTTTTGTTATGTTGAGAGTTTCTAA
AATGTTATGGCAGAACTATATTACTGTCACAATCCACTG
Genomic location of cLEX-13-G5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3083 marker 3083
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)