SGN Marker T1928

SGN-M3088
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39789)
Chromosome
6
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1928 was used as an overgo probe on plate 3 [well A4]

Plausible BAC Matches:   P259K16,   P114O13,   P166G10,   P282D09,   P176K10,   P015F13

 Overgo Sequences

A sequence
CATCAAGAGATCCTCCGGAGAAAC
B sequence
GTGCACATTGGTGCTTGTTTCTCC
AB sequence
CATCAAGAGATCCTCCGGAGAAACAAGCAC
Marker sequence
GGGGATCTGGTGCCCTGGGTTGTGAGTTCCTGAAGAACTTGGCTTTAATG
GGAGTTGCATGCACCGAGCAAGGGAAATTAACAGTGACTGATGATGATGT
CATTGAGAAGAGTAATCTCAGTAGACAATTTCTCTTCCGTGATTGGAACA
TCGGCCAGGCAAAATCTACTGTTGCTGCTGCTGCTGCAACATCAATAAAT
CCCCAGCTCCGGGTTGAAGCTTTGCAGAACCGTGTGGGTCCTGAAACTGA
AAATGTGTTTGATGACACTTTCTGGGAGAATCTTAGTGTGGTTATTAACG
CACTTGACAATGTCAATGCAAGACTTTATGTCGATCAGAGATGCTTGTAC
TTTCAGAAGCCACTGCTTGAATCAGGGACCCTTGGAGCCAAATGTAACAC
TCAGATGGTGATTCCCCATCTGACTGAGAATTATGGTGCATCAAGAGATC
CTCCGGAGAAACAAGCACCAATGTGCACTTTGCATTCCTTCCCACATAAT
ATAGATCATTGTTTGACATGGGCACGATCCGAATTTGAAGGTTTGCTTGA
GAAGACACCAGCCGAAGTGAACGCTTATCTTTCT
Genomic location of T1928  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3088 marker 3088
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)