SGN Marker cLET-5-A4

SGN-M3091

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87537
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51102)
Chromosome
6
Position
20.39 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49038)
Chromosome
6
Position
11.32 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40394)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-A4 was used as an overgo probe on plate 3 [well F5]

Plausible BAC Matches:   P117A12,   P309K01,   P314C15,   P215K12,   P311D13,   P311H02,   P220P22,   P030H14

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACAAGGCCTAGCATGATGCACTAC
B sequence
CATCCCTCGTCATTGTGTAGTGCA
AB sequence
ACAAGGCCTAGCATGATGCACTACACAATG
Marker sequence
TCTGGCCAAGGAGTTGAAGTTGTGTATGATTCTGTTGGAAAAGATACTTT
TCAGGGATCATTAGACTGCTTAAAAACTCGTGGATACATGGTGAGTTTTG
GGCAGTCATCTGGCTCACCAGATCCAGTACCTTTATCAGCTCTTGCAGTG
AAATCGCTATTTCTGACAAGGCCTAGCATGATGCACTACACAATGACGAG
GGATGAACTACTAGAAACTGCCGGAGAGGTATTTGCTAATGTGGCATCAG
GTGTCTTACGCGTCCGTGTGAATCATACTTATCCCCTGTCTCAGGCGGCA
CAAGCACATACCGACCTTGAGAGCAGGAAAACAT
Genomic location of cLET-5-A4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3091 marker 3091
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)