SGN Marker cLET-4-G23

SGN-M3094

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87399
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51090)
Chromosome
6
Position
32.62 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49026)
Chromosome
6
Position
34.69 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40391)
Chromosome
6
Position
28.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-4-G23 was used as an overgo probe on plate 2 [well G3]

Plausible BAC Matches:   P281A07,   P196F24,   P167M06,   P261A18,   P010O24

 Overgo Sequences

A sequence
GAAGGATTGTGTTGCAGTAGATGG
B sequence
CACTGCCACAATAACCCCATCTAC
AB sequence
GAAGGATTGTGTTGCAGTAGATGGGGTTAT
Marker sequence
AAAAAAAAATGATAAATTTTTCTTCAAGAATTTTGTTGATTTTGTTATTA
ACATGTACTATAGCTATAATTATAATTCCAAAATTGGCTTCTACACAATA
TTGTGGATGTACAGAAGGATTGTGTTGCAGTAGATGGGGTTATTGTGGCA
GTGGAAAAGCTTATTGTGGACAAGGTTGTCAAGGAGGGCCTTGTTATAAT
TCTTCAACCAAAAATTACAATCATAATATTAATAACAATAATAATAATAA
TACCAATAGAGTTTCTGATATTGTTAGTGAATCATTTTTCAATGGAATTG
CAAATCAAGCTGCTTCAAATTGTGAAGGCAAAGGATTTTACACGAGATCT
GTATTTCTTGAAGCTTTAAAGTCTTATCCTGAATTCGCAACTATCGGGTT
TTCTGATGATGATAATAAGCGCGAAATTGCTGCTTTCTTTGCTCATGTCA
CACATGAGACCGGACAAATGTGTTACATAAATGAGATAAATGGTTCATCT
AGGGACTATTGTGACATGACAA
Genomic location of cLET-4-G23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3094 marker 3094
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)