SGN Marker cLET-19-J2

SGN-M3109

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82044
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51086)
Chromosome
6
Position
42.27 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49022)
Chromosome
6
Position
75.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40362)
Chromosome
6
Position
74.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-19-J2 was used as an overgo probe on plate 4 [well D2]

Plausible BAC Matches:   P235O17,   P099H05

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCTCAGACTTCATGAGATCACCAG
B sequence
GGGTTTCTTGCTGTCACTGGTGAT
AB sequence
CCTCAGACTTCATGAGATCACCAGTGACAG
Marker sequence
CCGTAACACTAACACAAACACTATTCGGAGAAGAAGAAAACAAGAATGGC
AGCAACAATGTCCAGTGTTGTAGGCTTAGCTAACTCATCTCTTTCTGGAT
TTTCTTCTGCAAAGAAGACTAGCCTTTCCTCAGACTTCATGAGATCACCA
GTGACAGCAAGAAACCCTTTAAGGGTAGCAAAAGCTTCAGGAGGCAGAGT
TACATGTTTCCAGAGGGACTGGCTAAGAAGAGACTTGAATGTGATTGGAT
TTGGTTTGATTGGATGGTTGGCTCCTTCAAGTGTTCCAGCAATCAATGGA
AAGAAG
Genomic location of cLET-19-J2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3109 marker 3109
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)