SGN Marker cLPT-5-K21

SGN-M3114

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110623
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40473)
Chromosome
6
Position
96.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-K21 was used as an overgo probe on plate 2 [well D11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P001J06,   P109P17,   P066A04

 Overgo Sequences

A sequence
GATGCCACACGTATTCTTCGTGAG
B sequence
GCCGAAGAAGCTTGATCTCACGAA
AB sequence
GATGCCACACGTATTCTTCGTGAGATCAAG
Marker sequence
AGGGGGGTAGTATGTTCTGCGTTTGATACCCATCTAGGGGAAAAAGTTGC
AATCAAGAATATAAATGACATCTTTGAACATGTCTCTGATGCCACACGTA
TTCTTCGTGAGATCAAGCTTCTTCGGCTTCTTCGGCATCCAGATATAGTG
GAAATCAAGCATATATTGTTACCTCCTTCTCGGAGGGAATTCAAGGATAT
CTATGTTGTCTTTGAACTCATGGAATCTGATCTGCATCAAGTCATTAAAG
CAAATGATGATCTTACGCCGGAACATTATCAATTTTTCCTTTATCAGCTT
CTTCGAGGGCTGAAATATATACACACAGCCAATGTCTTTCACCGTGACCT
GAAACCCAAAAATATATTAGCAAATGCTGATTGCAAGCTTAAGATCTGTG
ACTTTGGTCTTGCAAGAGTGGCCTTCAATGATACTCCAACAGCTATATTT
TGGACTGATTATGTTGCTACGAGGTGGTATAGGGCTCCTGAATTGTGTGG
ATCATTTTTCTCTAAGTATACACCAGCAATTGATATATGGAGCATTGGAT
GTATATTTGCAGAACTACTAACTGGGAAGCCTCT
Genomic location of cLPT-5-K21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3114 marker 3114
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)