Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker cLED-21-J7

SGN-M3120

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C18006
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51071)
Chromosome
7
Position
2.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49007)
Chromosome
7
Position
7.85 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40304)
Chromosome
7
Position
4.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 12762)
Chromosome
7
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
cLED-21-J7 was used as an overgo probe on plate 8 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCAGCTGTATTTCAGTCCTCTTC
B sequence
TTGCCTCGAAGCAGAAGAAGAGGA
AB sequence
GGCAGCTGTATTTCAGTCCTCTTCTTCTGC
Marker sequence
CCTTGCAACTTTTGCAATATTTGTTCTTGCGGTGAGTGTTCCATGCAGTA
GCCTATTTGATATTGTGACTGTTCGTTGTGGACATTGCACAAATTTATGG
TCCGTTAATATGGCAGCTGTATTTCAGTCCTCTTCTTCTGCTTCGAGGCA
AAATCATCAGGTTCCAAACTACACTGCTCCTGAGAATAGGATGGATTTTG
GTTCATCAACCAAATGC
Genomic location of cLED-21-J7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3120 marker 3120
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)