Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker cLET-6-N21

SGN-M3124

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88067
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40409)
Chromosome
7
Position
22.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-6-N21 was used as an overgo probe on plate 7 [well G10]

Plausible BAC Matches:   P007F15,   P028C05,   P191N02,   P319G10,   P071E11,   P229N08,   P306C17,   P241P05,   P314J24,   P026O03

 Overgo Sequences

A sequence
CAAAGTCTCAGTCTGCTGGGTTAC
B sequence
CAAGCGGGAATAGACAGTAACCCA
AB sequence
CAAAGTCTCAGTCTGCTGGGTTACTGTCTA
Marker sequence
CCTGTTCCTGCCATTCCATCTCCACCACCCCTACCTTCATCTGGACAGTC
AAATATAGCTGCTACCGGATTCGGATCGCCTCCCAATACCCTTACCGAAC
CCGTTTGGGATACCGTCAAAAGAGATCTGTCCAGAATTGTTAGTAATTTG
AAGCTGGTGGTTTTCCCTAATCCTTATAGAGAAGATCCTGGCAAAGCTCT
TCGTGATTGGGATCTATGGGGACCTTTCTTCTTCATTGTTTTCCTTGGTC
TCACTTTGTCATGGTCTGCTTCTGTTAAGAAGTCTGAGGTTTTTGCTGTT
GCATTTGCTCTGCTGGCTGCCGGTGCTGTCATTCTGACACTGAATGTATT
GTTACTGGGCGGTCATATAATCTTCTTCCAAAGTCTCAGTCTGCTGGGTT
ACTGTCTATTCCCGCTTGATATTGGTGCTTTCATTTGCATGCTAAAGGAC
AACGTGATATTGAAGGTAGTTGTAGTATGTGTTGCACTAGCTTGGAGCTC
TTGGGCGGCATACCCCTTCATGAGTACAGCTGTTAACCCTAGAAGGAAAG
CTCTTGCCCTGTATCCTGTAGTACTCA
Genomic location of cLET-6-N21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3124 marker 3124
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)