SGN Marker cLPT-1-I9

SGN-M3127

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109913
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40456)
Chromosome
7
Position
22.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-I9 was used as an overgo probe on plate 8 [well B8]

Plausible BAC Matches:   P163J14,   P180A02,   P224G23,   P289N06,   P290D09

 Overgo Sequences

A sequence
GTGAGTTTTGATGCGGTGGTCAGT
B sequence
ACAAATAGGCGAGCACACTGACCA
AB sequence
GTGAGTTTTGATGCGGTGGTCAGTGTGCTC
Marker sequence
GCCTCATATAATTCCTAACTAGCTAACTACCCCTTGTTCAATTTCTTTTC
TCTCCCCAAATTCAATGGCTCTTTCTTCCAAATGATCCCTCTATTCCCCC
TTTCTCCCATGAACGTATGCTCTAATGGATAGTAGAACTGCTTTTTCGGA
TTCCAATGATATTAGTGGAAGCAGTAGTATATGCTGCATGAACGAATCGG
AAACTTCACCGGCAGACGTCAATTCCCTCAAACGTCTATCAGAAACACTA
GAGTCTATCTTCGATGCGTCTGCGCCGGATTTCGACTTCTTCGCTGATGC
GAAGCTTCTGGCTCCAGGCGGTAAGGAAATTCCGGTGCACCGGTGCATTT
TGTCGGCGAGGAGTCCTTTTTTTAAGAATGTATTCTGTGGGAAAGATAGC
AACACGAAGCTGGAACTCAAAGAGCTGATGAAAGAGTATGAGGTGAGTTT
TGATGCGGTGGTCAGTGTGCTCGCCTATTTGTATAGTGGAAAAGTTAGGC
CTGCATCTAAAGATGTGTGTGTTTGTGTGGACAATGAGTGCTTGCATGTA
GCTTGTA
Genomic location of cLPT-1-I9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3127 marker 3127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)