Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG17

SGN-M313

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CGGCTGTGTACGTATCTGGAGCATGTGGATTCCTGGATGTCCTGTCATAGAAAGAAATCCACCCACCCAAACTGTTGTTACAATGAAAAA
ACATTTCCTAAATGGAGTGGAAAGTTAAAATTGTCAGAATTCACGTACATAGCAATCTCTCCCCCCCCCCCCCCCCTAGGTTTTTAAAAT
Reverse sequence
CTGCATCTCTTCACTAGTAAAAATCAATTGAACCGGCTGTTTGTTAGAAATGGGGAAAAAGTTAGTGAAGTTGCCGGCGACTGAAGTTGA
CATGACGGCCGCTAAGTATACGCCTCAAAGAGTTCAAGGTCTTCCCTTCGTCATTCATAATTTGTTTGCAATTTCCCCCCTTTTTTTTAA
GACTTTAAAAGCTAAATTTCAAGTATTAGATTAGTTTACGTTTGTTAAAAGATAAATAAATAAAGAGTTAGATATTCGGAAATACACAAA
AAAGTATCATAAGTTTGGAATTTTCATATCAAAATGGTGGAATATTGATACAATCTTAAAATATTTGTTAAAGTTACGTATGGTAGGAAA
TAGTTGTTGTTATAAATCTGTATTGTTATTTCGAGTTATTCAGTTGAGAATTTGCACCTACGGACATGCAGCTCCACATCTGACTGGATT
TTGGTTGAAGTTATTTGTCATGTTGATTGAAGCACCAATTATTGGTTCAATGATCTTGATTCTCGTGAAGAACAAGAACCGAATAACCAA
GGTTGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53854)
Chromosome
1
Position
19.20 cM
Confidence
uncalculated
Protocol
RFLP

Hexanal_content_hxa1_1 Pentanal_content_pna1_1 Titratable_acidity_ta1_1 Elasticity_ela1_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53201)
Chromosome
8
Position
66.50 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53197)
Chromosome
1
Position
99.61 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50350)
Chromosome
1
Position
86.03 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48285)
Chromosome
1
Position
130.22 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39921)
Chromosome
1
Position
142.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8865)
Chromosome
1
Position
111.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8869)
Chromosome
1
Position
68.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG17 was used as an overgo probe on plate 5 [well F2]

Plausible BAC Matches:   P269L16,   P292N22,   P079N04

 Overgo Sequences

A sequence
CTGTGTACGTATCTGGAGCATGTG
B sequence
AGGACATCCAGGAATCCACATGCT
AB sequence
CTGTGTACGTATCTGGAGCATGTGGATTCC
Marker sequence
CGGCTGTGTACGTATCTGGAGCATGTGGATTCCTGGATGTCCTGTCATAG
AAAGAAATCCACCCACCCAAACTGTTGTTACAATGAAAAAACATTTCCTA
AATGGAGTGGAAAGTTAAAATTGTCAGAATTCACGTACATAGCAATCTCT
CCCCCCCCCCCCCCCCTAGGTTTTTAAAAT
Genomic location of TG17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D313 marker 313
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)