SGN Marker T1962

SGN-M3130
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39809)
Chromosome
7
Position
25.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1962 was used as an overgo probe on plate 8 [well H4]

Plausible BAC Matches:   P106F06

 Overgo Sequences

A sequence
AAATGGCGTCCACTCAGCTAACAG
B sequence
CCAGAGATAGAGGATGCTGTTAGC
AB sequence
AAATGGCGTCCACTCAGCTAACAGCATCCT
Marker sequence
CTTATCCAAATTCAGAAAAAAAATGGCGTCCACTCAGCTAACAGCATCCT
CTATCTCTGGCAATGGTTTTGCATCCTTTGAAGGGCTCAGGTCCACTTGC
ATTGTAAAGACCGTATCTTTTGCTCCTTTGAAGCACAACAACAGCAGGTC
TTTTAGTCGTCTTGTTGTCAAGGCGGCTACCACCGTAGCTCCTAAGTACA
CTACACTTAAGCCTTTGGGCGACAGAGTCTTGGTGAAGATTAAGACTGCA
GAGGAGAAGACTGTTGGTGGTATCCTACTTCCAGTATCAGTTCAGTCGAA
ACCTAATGGAGGTGAGGTGGTTGCTGTTGGGGAGGGTCATTCAGCTGGCA
AAACCAAAGTGGACATTAGTGTGAAGACTGGTGCCCAAGTCATCTACTCG
AAGTACGCAGGAACTGAGGTGGAGTTTGATGGATCAAAGCACCTCATTCT
GAAAGAGGATGATATTGTTGGTATTCTTGAGACAGATGATGTCAAGGATC
TGCAGCCATTAAATGACAGAGTCCTAATCAAGGTTGCAGAAGCTGAAGAA
AAAACCGCTGGAGGTTTACTGTTGACTGANGCAGCCAAGGAGAAGCCTTC
AATTGGCACGATTATAGCTGTTGGGCCTGGTCCTCTTGATGAAGAAGGGA
ACAGGAAACCACTTTCAGTATCCCCAGGAAATACAGTTCTCTATTCCAAA
Genomic location of T1962  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3130 marker 3130
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)