SGN Marker cLEX-13-I3

SGN-M3139

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C93052
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40436)
Chromosome
5
Position
13.00 cM
Confidence
I(LOD2)
Protocol
CAPS
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40437)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35666
Forward primer (5'-3')
TGAAGAAGCTAGTCATGGCAAC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 350+450
Solanum lycopersicum LA925: 600
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCATCCACGATCTCGATTACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLEX-13-I3 was used as an overgo probe on plate 8 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGATGAAGCTTGGCTTAATGGTCC
B sequence
AGAAGGAAGAATGGCGGGACCATT
AB sequence
CGATGAAGCTTGGCTTAATGGTCCCGCCAT
Marker sequence
CTCTGCTTATTAGTCATTCTTTCAATATTTGTTGTTGAAGAAGCTAGTCA
TGGCAACAAATAGTGTAAAGCTTCTAGGTACATGGGCATGCCCGTATGTG
TATCGCGTTGAAATAGCCCTCAAGATGAAGTCTATTGAGTATGAGTTTAT
ACAAGAACGTGTGTTTAACAAAAGTGAGTTGCTTCTCAAATCCAATCCTG
TTTACAAGAAAATCCCAGTTCTGTTCCACGACGAGAAGCCTATCTGTGAG
TCCCTTGTCATCCTTCAGTACATCGATGAAGCTTGGCTTAATGGTCCCGC
CATTCTTCCTTCTGATCCCTATGATCGTGCCATAGCACGATTTTGGGCAG
CCTATATAGATGAAAAGTGGTATCCATTGGTAGCGGATTATAGGAACGTG
GAAGGAAAGGAAGCAAAAGCAGCTATGGTGGAGAAAATTTCTGAAGGGAC
TTTGCTGCTGGAGGAAGCTTTTATCAACATGAGCAAAGGTAAATCTTACT
TTGGTGGAGATAGTATTGGTTATGTTGACATTG
Genomic location of cLEX-13-I3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3139 marker 3139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)