SGN Marker TG538

SGN-M314

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTCTGGGCCAAGTGCAGAGAGTACTGGAGGACCTGATGGCTACACAGGAAAGTTTTTATCAAGCTTGTTGGGATATAATTGCTAACGAT
ATGACAAAAATGGAAAAATCCTTCTTTTGGGGACACAAGTTACCTATACATTACATGTACAAATCTGATTTTAATTCGCAAGAAGAAAGA
AATCACCACTTTTTCAGATATGAGTCCTATTAGCCTGAGAGATTTTACCAGCAAGGTTATTTCAAGAATCATTCATGAGAGAATAGTGAA
GTTGCTACCAACAATAATCTCGCCGCAACAATCAGGCTTTGTTAAAGGCAGAAGTATTGTGGAGAACATATTATTAGTCCAAGAAATAGT
TCATGATATCAGAATTAGAGGTAAGCCGACCAATGTTGTACTCAAACTAGACATGGCAAAAGCTTATGATAGAGTATCATGGCTTTTCTT
GACTAAAGTTTTAAGGAAGATGGGTTTTGGGGAGAT
Reverse sequence
ACTGTACTTAATAAAGCATCCACTAATGCACTCCGTTTATATGGCATATTCTTCCTCCTTGTCTGAATGAACATGATCAAAGTATGCATT
ATCTGATAGAACAACTTATTATTGGCACTCTTCCGTCCCCTATGTCTTAGTGTGGTTCTCCTCTTCCATAATTCCCACACTATGATAGAG
GGGACAACTTGAAATATATACATAACTTGCTGATGTACATTTATCTCTCCCACAATTTGTTATCACTTGAGATAAGAGAAGATTCTCAAT
ATTAGTACATACTGGTCTACAAAAATGTTTCCATACCATTTGGGCTGTAGCTCTGGATAACTATTCCGCAGCCAATATGAATAATGTTGG
TGATAAAGGGTCTCTTTGTTTCAGTCCTCTGGTAGACTTAAAGAACCCCTTTGGTTGTCCATTAACTAGTATAGAGTACCAGTTGTTGGA
AATGATTTTGTACACCATGTCTATCAGTATCTCCCCAAAACCCATCTTCCTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8870)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG538 was used as an overgo probe on plate 14 [well E4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P294N05,   P074M03,   P291E12,   P162E23,   P292H11,   P205O12,   P206H03,   P329C01,   P115J03,   P196N05,   P073B02,   P054D21,   P069B03

 Overgo Sequences

A sequence
AGTGCAGAGAGTACTGGAGGACCT
B sequence
TTCCTGTGTAGCCATCAGGTCCTC
AB sequence
AGTGCAGAGAGTACTGGAGGACCTGATGGC
Marker sequence
TTTCTGGGCCAAGTGCAGAGAGTACTGGAGGACCTGATGGCTACACAGGA
AAGTTTTTATCAAGCTTGTTGGGATATAATTGCTAACGATATGACAAAAA
TGGAAAAATCCTTCTTTTGGGGACACAAGTTACCTATACATTACATGTAC
AAATCTGATTTTAATTCGCAAGAAGAAAGAAATCACCACTTTTTCAGATA
TGAGTCCTATTAGCCTGAGAGATTTTACCAGCAAGGTTATTTCAAGAATC
ATTCATGAGAGAATAGTGAAGTTGCTACCAACAATAATCTCGCCGCAACA
ATCAGGCTTTGTTAAAGGCAGAAGTATTGTGGAGAACATATTATTAGTCC
AAGAAATAGTTCATGATATCAGAATTAGAGGTAAGCCGACCAATGTTGTA
CTCAAACTAGACATGGCAAAAGCTTATGATAGAGTATCATGGCTTTTCTT
GACTAAAGTTTTAAGGAAGATGGGTTTTGGGGAGAT
Genomic location of TG538  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D314 marker 314
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)