SGN Marker cLPT-2-K10

SGN-M3141

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110146
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40461)
Chromosome
8
Position
6.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-2-K10 was used as an overgo probe on plate 12 [well B9]

Plausible BAC Matches:   P105N06

 Overgo Sequences

A sequence
CATCAGCCTAAGCCTTGATTGCAC
B sequence
ATCAGGCATGTCTGAGGTGCAATC
AB sequence
CATCAGCCTAAGCCTTGATTGCACCTCAGA
Marker sequence
ATTCTTTTGGTTTGTTGTAGCTACTTGGTGTAGCAAGGAAAAGCGGCAAG
ATTGAGGTTCTTAGTCCAGTCAATGGAGATGTTCGTGCATCCATTTCAAT
TGAAAGTCAAAATCATCCAGGATCGGCAGATAATTCTATTGTTGGTTTGC
ATTTATTCAAAGGAGAAAGATTGGGATCATCATCAAGGTATTATCTTGTC
CTGCTTTAGACAATACGAGCAGGAAGTGTCTAATTAATTACCTTAGTTAC
CTTATGGAATAAGCAACTAGTAGAGGTAGACATATTGTTAGACTCTTCCT
AGCAGAGTGCAAATGGTACAAAACTTTTCAAAATGTGGGTTAAAAGACTA
CTTGTGTAGGTCGGGGTTGAGAATTGGGGGCCCGCACCCTATCCCATCAG
CCTAAGCCTTGATTGCACCTCAGACATGCCTGATATAGATATACTAAGAA
CTAGGACATGCATCTTTGACACATTAAGATGCCATGACTCGACTATCCAA
GTCGGAAGTACGAACCACTCAATGAAGAATCTCAAGCCAAATTGGATCAG
GTTCAGTGCTTGGATTG
Genomic location of cLPT-2-K10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3141 marker 3141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)