SGN Marker cLET-3-M1

SGN-M3145

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85660
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40385)
Chromosome
8
Position
21.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-M1 was used as an overgo probe on plate 12 [well E6]

Plausible BAC Matches:   P210K12,   P267I13,   P006I18,   P323M11,   P073N16,   P219N08,   P040J09,   P138N04,   P134F19,   P168D01

 Overgo Sequences

A sequence
TGAGCAATAGCATCCCTTGCAAGC
B sequence
GATCGACCAATGCTAGGCTTGCAA
AB sequence
TGAGCAATAGCATCCCTTGCAAGCCTAGCA
Marker sequence
GCCAAGTCAATTTTCTTCTATCAATCTCTAATTGAAGTATGAAATACAAT
ATTTGTCTGCAGTGTATGCTAGAAAAGCAACATTTTCATCCGTTTGCACA
CTAACTTAACTTAAGAAAAACAAATGTGAAAATATAAGTAATAACTTGAA
AGAATTACATGAATCAAAGTTTTCCCTCCTTTGATTGTATTAAAGGAGAG
AAGTACCAGCATGGTTATGGTGTAGAAGATTATGAGCAATAGCATCCCTT
GCAAGCCTAGCATTGGTCGATCTCAATTGAATCTCTGGAAGCATTTCATC
ATCAATGAGCTCGAAATTGAGTTCTGGATCCATCTCCTCATTCCTCATCT
GGCAAATATTATGCAAGACGCAGCACGCCCCTAGCACCACTGGCAAATCT
TGTAGTTTCACCTCTGTTCTTTTCTGCAAACAAGACCATCTCCTTTTCAA
CCTTACAAACGCCTCCTTTGCCACCCGTTGAACCTCACCAATCTTCTCAT
TGAAAGCATGTTGAGTCCAAGTTAGCTGCTGCTGTGTATAAGGCACTAAA
ACCCAATCCATTAAAGGGTATCCAGAACTACCAACAATCCAAACGTTGTT
CA
Genomic location of cLET-3-M1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3145 marker 3145
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)