SGN Marker TG396

SGN-M316

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG396 image not available
Forward sequence
CAAAAAATCTGTTTCTCGGGAATTGAAGAGTCAGTGATAGAACCCTGCTGTTGCTGATACTCAGAAAATAGTACAAATACTTTGCTCTGG
GGGGTTCCTTTAACCCAGCCATCTCTGAAATGACCCTTTGTATGGCCTGCTATGGCCTGGCTTGAAGGGAAGTTTTTTTTACAATGGATG
CATTGGAACATCCACATACCCTGCTGCCCATTTTGTCCCTGTATTGTTGTTACTTCCATGATAATCGAAGAAGAGGAATACATATAAAGG
AGCTCTAACCAAGTAATTTTTAAAAACAAAGTTGGCATAAAAAAAGTCATTGCATCATAAAGATATAACAACAAGGAGTACACAATTGCA
ACTCCGTTATTTTGGATTTATCTTTTTCTATTTGACCATAAATAATGGAACTCTTAAGTTTCTTTTTTTCAATTGATTTTGTCCTAATAA
ATAAATAGTTGAAATATTTGCTTTTAAAAGGCAATGATGACTTGTTCCAACTATTTATGGTCCTT
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGATATTTACTACAGTTGTCTTCTTCTCTTCATTTAATGAGATATCAGTGATGCCTCAT
CAGAACCAGGTATTATTGTCATCAGGGAATAGAGTGAATTGTGAAACAAATAGGAAATAATGCAATACTTGGGTAGAGTTTCAGTGAATA
TAATATCCCTTCTCTTATAAGGTAATTAGGGAATGAAAATCCTACATATGACAAGTAAGAAGAATCATTGGAAGGAATGAACAATATATG
TCACATCCTAATTCTATTCTGTGATAAGGTTCCCTGGTTCATAAACTCTAAGCTGACTGGTCATATCTCTCTACCAAGAGAAAATAGGGA
AAATACCATACTCTTAAGATTCTATAAACCCTTGATTGGTACATATACTTTTTAAGTTTGTAACTCTACCTGCTTTCTTAACCTAGTGAT
GGAGTTACCTAATGTGTTGAACCCCTGAAGGATCAAGGACCATAAATAGTTGGAACAAGTCATCATTGCCTTTTAAAAGCAAATATTTCA
ACTATTTATTTATTAGGACAAAATCAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1521522e-105220 (42.7% of RFLP seq)+
SGN-U1540508e-139306 (59.4% of RFLP seq)+
SGN-U1521525.6e-3269 (12.1% of RFLP seq)-
SGN-U154050367 (64.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8874)
Chromosome
2
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG396 was used as an overgo probe on plate 16 [well H1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCAGCCATCTCTGAAATGACCCTT
B sequence
CATAGCAGGCCATACAAAGGGTCA
AB sequence
CCAGCCATCTCTGAAATGACCCTTTGTATG
Marker sequence
CAAAAAATCTGTTTCTCGGGAATTGAAGAGTCAGTGATAGAACCCTGCTG
TTGCTGATACTCAGAAAATAGTACAAATACTTTGCTCTGGGGGGTTCCTT
TAACCCAGCCATCTCTGAAATGACCCTTTGTATGGCCTGCTATGGCCTGG
CTTGAAGGGAAGTTTTTTTTACAATGGATGCATTGGAACATCCACATACC
CTGCTGCCCATTTTGTCCCTGTATTGTTGTTACTTCCATGATAATCGAAG
AAGAGGAATACATATAAAGGAGCTCTAACCAAGTAATTTTTAAAAACAAA
GTTGGCATAAAAAAAGTCATTGCATCATAAAGATATAACAACAAGGAGTA
CACAATTGCAACTCCGTTATTTTGGATTTATCTTTTTCTATTTGACCATA
AATAATGGAACTCTTAAGTTTCTTTTTTTCAATTGATTTTGTCCTAATAA
ATAAATAGTTGAAATATTTGCTTTTAAAAGGCAATGATGACTTGTTCCAA
CTATTTATGGTCCTT
Genomic location of TG396  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D316 marker 316
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)