SGN Marker cLET-3-C15

SGN-M3165

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85531
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40381)
Chromosome
9
Position
32.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-C15 was used as an overgo probe on plate 16 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCTGTCAAGGCAATATTTGCCAG
B sequence
AGACTTCCCTTGCTCACTGGCAAA
AB sequence
GGCTGTCAAGGCAATATTTGCCAGTGAGCA
Marker sequence
CAGAGGGCATAGCTGCGTTCTATGAAGGTTATTATAAAAACAAGGGAGTC
AATATTATCAAGGGTACAGTGGCTGTTGGGTTTGATACCCATCCAAATGG
AGAGGTGAAGGAAGTCAAACTCAAAGATGGCAGAGTTTTGGAAGCTGACA
TAGTAGTCGTAGGAGTCGGAGCAAGACCACTCACAACTCTATTCAAAGGG
CAAGTTGAAGAGGAGAAGGGTGGAATTAAGACAGATGCGTTCTTCAAAAC
AAGTGTACCTGATGTATATGCTGTGGGTGATGTTGCCACTTTTCCTTTGA
AAATGTACAATGAGATTAGAAGAGTTGAACATGTTGATCATTCTCGCAAA
TCTGCTGAGCAGGCTGTCAAGGCAATATTTGCCAGTGAGCAAGGGAAGTC
TGTCGATGAATATGACTACCTTCCATACTTCTATTCCCGCGCCTTCGATT
TGTCTTGGCAATTCTACGGTGATAATGTGGGTGAAACAGTGCTCTTTGGG
GACGCTGATCCCAACTCTGCAACTCACAAGTTTGGACAATACTGGATCAA
AGATGGAAAGATCGTTGGTGCATTCCTCGAGAGTGGGTCACCTGAAGAGA
ACAAGGCAATTGCTAA
Genomic location of cLET-3-C15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3165 marker 3165
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)