SGN Marker TG21

SGN-M327

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG21 image not available
Forward sequence
TGGGCTGCGTGATAGGGGAGAAATACATGAAGCAAAGGAAGAGGCTTTAACGGATGGGCATGGAGAAAAGCGAAGGACTCTATTATTGTC
TTCAAGCACTAAAACAGTGAGGATAATTTTAATCCATGATTCAAAGCTTTCCAGCTTATAAAATCCTCCGAAGGAGGCTTTAGCTATGTT
ACTTCAATAGGAACTTAAATTGCCTCAGAGATGAAGAACAAAAAGCACCTCATTTCATACTAAGGAGTTTGTTTAAATGCGAGTTGCCTT
ACGGCCTAAGATCTGGAATAAGTGCATATGTACTTTGGCGAAGATTCTCCTTTCTCTATGTTTCTCATTTTAGCATGTAAGGAAATCATT
TTTCTTCAGTAGCACATCCGAAGAACTTTTAGATGCTAACAACTTACAGGAATGAAAATCAAAGAGTACCAGACCCAAATCCCATAAAAT
TCTTCAAGAGTTAAGTGGTTGATATAAATCATTCAATTCACAATCCAAACCAGTTAAATTGGTTACACAAATCCCCTTCCGTTGATTCCT
CTCAATCAGATCCTTTCCATTCCAACAAAAGAGAAC
Reverse sequence
GGGAGAAATACATGAAGCAAAGGAAGAGGCTTTAACGGATGGGCATGGAGAAAAGCGAAGGACTCTATTATTGTCTTCAAGCACTAAAAC
AGTGAGGATAATTTTAATCCATGATTCAAAGCTTTCCAGCTTATAAAATCCTCCGAAGGAGGCTTTAGCTATGTTACTTCAATAGGAACT
TAAATTGCCTCAGAGATGAAGAACAAAAAGCACCTCATTTCATACTAAGGAGTTTGTTTAAATGCGAGTTGCCTTACGGCCTAAGATCTG
GAATAAGTGCATATGTACTTTGGCGAAGATTCTCCTTTCTCTATGTTTCTCATTTTAGCATGTAAGGAAATCATTTTTCTTCAGTAGCAC
ATCCAAAGAACTTTTAGATGCTAACAACTTACAGGAATGAAAATCAAAGAGTACCAGACCCAAATCCCATAAAATTCTTCAAGAGTTAAG
TGGTTGATATAAATCATTCAATTCACAATCCAAACCAGTTAAATTGGTTACACAAATCCCCTTCCGTTGATTCCTCTCAATCAGATCCTT
TCCATTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53218)
Chromosome
1
Position
52.67 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8896)
Chromosome
1
Position
47.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8897)
Chromosome
1
Position
37.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8898)
Chromosome
1
Position
18.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG21 was used as an overgo probe on plate 15 [well E6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P150B11,   P210F09,   P100M24,   P258E05,   P112C18

 Overgo Sequences

A sequence
GAAGAGGCTTTAACGGATGGGCAT
B sequence
TCCTTCGCTTTTCTCCATGCCCAT
AB sequence
GAAGAGGCTTTAACGGATGGGCATGGAGAA
Marker sequence
TGGGCTGCGTGATAGGGGAGAAATACATGAAGCAAAGGAAGAGGCTTTAA
CGGATGGGCATGGAGAAAAGCGAAGGACTCTATTATTGTCTTCAAGCACT
AAAACAGTGAGGATAATTTTAATCCATGATTCAAAGCTTTCCAGCTTATA
AAATCCTCCGAAGGAGGCTTTAGCTATGTTACTTCAATAGGAACTTAAAT
TGCCTCAGAGATGAAGAACAAAAAGCACCTCATTTCATACTAAGGAGTTT
GTTTAAATGCGAGTTGCCTTACGGCCTAAGATCTGGAATAAGTGCATATG
TACTTTGGCGAAGATTCTCCTTTCTCTATGTTTCTCATTTTAGCATGTAA
GGAAATCATTTTTCTTCAGTAGCACATCCGAAGAACTTTTAGATGCTAAC
AACTTACAGGAATGAAAATCAAAGAGTACCAGACCCAAATCCCATAAAAT
TCTTCAAGAGTTAAGTGGTTGATATAAATCATTCAATTCACAATCCAAAC
CAGTTAAATTGGTTACACAAATCCCCTTCCGTTGATTCCTCTCAATCAGA
TCCTTTCCATTCCAACAAAAGAGAAC
Genomic location of TG21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D327 marker 327
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)