SGN Marker TG616

SGN-M329

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG616 image not available
Forward sequence
GAGACACGCTTGCATGCCTGCAGATATAATAAGCAGCACATAACTATACTTGTTTCCTTTTTCCTTACTCCTTGTGTTTGAAAGATGAAA
GCAATAACTAATCAAACAACAAAAGTACAGATATGTACCCTTTTTTAATAGAAATTTCAAAATCCAATGTTCTGATGGTCTAATTGACTG
AGAGCAACCAAGCAATATTTTCTACTGCTTCCAATAACAACATACAGATTTAAATAATACTAAAAGAAATTACCTTATGTAGAAGATTAC
TTCACTGGTTTAGCAGAATCTCCCCACAATTCCTTTCTGATCAGCTTAAGAATTTCAATAATCTGTATTGAATGAAAGGGATATGTAAAC
AACATACAATGTATACCTCTTACAAAATAGGCTTCAGGGGGAACTGCGATTCGTCAAACTATTTACATCCCTAAACCCCCAATTCCTCCA
CCCATCCCCTGAAATTTGTTCACTAGCGGCGGGAGAAAGTCTTTTATCCTATTTGTCACTTAAATGCAACTACTAATAGTCACC
Reverse sequence
CTCCTATAGGGAGACACCTTGCATGCCTGCAGATATAATAAGCAGCACATAACTATACTTGTTTCCTTTTTCCTTACTCCTTGTGTTTGA
AAGATGAAAGCAATAACTAATCAGACAACAAAAGTACAGATATGTACCCTTTTTTAATAGAAATTTCAAAATCCAGTGTTCTGATGGTCT
AATTGACTGAGAGCAACCAAGCAATATTTTCTACTGCTTCCAATAACAACATACAGATTTAAATAATACTAAAAGAAATTACCTTATGTA
GAAGATTACTTCACTGGTTTAGCAGAATCTCCCCACAATTCCTTTCTGATCAGCTTAAGAATTTCAATAATCTGTATTGAATGAAAGGGA
TATGTAAACAACATACAATGTATACCTCTTACAAAATAGGCTTCAGGGGGAACTGCAATTCGTCAAACTATTTACATCCCTAAACCCCCA
ATTCCTCCACCCATCCCCTGAAATTTGTTCACTAGCGGCGGGAGAAAGTCTTTTATCCTATTTGTCACTTAAATGCAGCTACTAATAGTC
ACCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1630233.6e-3981 (15.2% of RFLP seq)+
SGN-U1630223.6e-3981 (15.2% of RFLP seq)+
SGN-U1525732.3e-4083 (15.5% of RFLP seq)+
SGN-U1630233.7e-3981 (14.9% of RFLP seq)-
SGN-U1630223.7e-3981 (14.9% of RFLP seq)-
SGN-U1525732.4e-4083 (15.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8902)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG616 was used as an overgo probe on plate 16 [well A7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCAATGTTCTGATGGTCTAATTG
B sequence
CTTGGTTGCTCTCAGTCAATTAGA
AB sequence
TCCAATGTTCTGATGGTCTAATTGACTGAG
Marker sequence
GAGACACGCTTGCATGCCTGCAGATATAATAAGCAGCACATAACTATACT
TGTTTCCTTTTTCCTTACTCCTTGTGTTTGAAAGATGAAAGCAATAACTA
ATCAAACAACAAAAGTACAGATATGTACCCTTTTTTAATAGAAATTTCAA
AATCCAATGTTCTGATGGTCTAATTGACTGAGAGCAACCAAGCAATATTT
TCTACTGCTTCCAATAACAACATACAGATTTAAATAATACTAAAAGAAAT
TACCTTATGTAGAAGATTACTTCACTGGTTTAGCAGAATCTCCCCACAAT
TCCTTTCTGATCAGCTTAAGAATTTCAATAATCTGTATTGAATGAAAGGG
ATATGTAAACAACATACAATGTATACCTCTTACAAAATAGGCTTCAGGGG
GAACTGCGATTCGTCAAACTATTTACATCCCTAAACCCCCAATTCCTCCA
CCCATCCCCTGAAATTTGTTCACTAGCGGCGGGAGAAAGTCTTTTATCCT
ATTTGTCACTTAAATGCAACTACTAATAGTCACC
Genomic location of TG616  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D329 marker 329
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)