SGN Marker TG472

SGN-M333

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG472 image not available
Forward sequence
CCTCTCCCATTTTGCGCATATAATACCTGATTCCAAGCATCGCATCTCGGGCTCCTAATAACCCTTTAACAATATCTGCTTGACTTGGTT
CATTTGCTCTCTCAAGCCACTATTCATGGTGAAAACCAGAAAAAACTTCAGTTCTAGAAGAAAATTTCATTAACTGTGGAAGGAATATTA
CATCATCCAATCAAAAAGTAATGATGCTCGATTTGAAGACAGAAATATTTGCAAGGAGGTACTTGGATTGTCTAAATAGTTGATCACGAA
AAAGTCATTCAGACATGCAGGAGAAAAGAATTGAATGACCTTTTTTAGATCGTCGGTGCCTTGCCTCCAAAACGTGATGGTACTAAAAAA
TAAAAAGGATTTTTGTTTGTGTAGAAACAACATAATGGAAGCTTCTCTAAGAAAAATGGTTGTTGGTTCCAGCTAATGGTTGCCACAAGC
AATTTGAACGACTCGAAGGAGGAGGATTAAGACTCCCAACAGAAAGAGGGCT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGCCTGCTTCCAGCAGAAAAGGTAAAATTCTTTTGGTCAGAATTGGAAAGGATGTTTAAGATCTAGTA
TTATGTAGAAATTTTGCGAACTATCCGTACTAAGTACGGAAGTTTTTTGCTTCATTTTATGCTTAATGGTAGGTGTAATTATCCTTGATA
CACTTAGCTTCTAACTTGTTCTGGAAAGGCTTACTCTGCTAAGTATCCATGGGTGTTTGAAGTGCAGAAAATTGGCTTAACTTTACTGAG
TTGATTCCGAACGATAGCAATGGTTACTTTCACCTTCTTGATAAGTCATACAACAATCATTACACCCTCAATCCCAAGTTGCTTGGGGTT
GACTACCTTCTTGATTAGTCATTCTCACTAAAAACCACCTGAAACTACAGCCGTAATAGCTGAAAAATGCATTACTTAAGAGCTAATGGA
AACAATTAACACAAACATACTGCAAGTGCAGGCTAACATATGTAGAATAAGGGATTTATTCCCTCTGTAAAAACAAATTACAAAAGATAC
CCTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50396)
Chromosome
6
Position
35.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48330)
Chromosome
6
Position
47.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40056)
Chromosome
6
Position
44.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8907)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG472 was used as an overgo probe on plate 4 [well G5]

Plausible BAC Matches:   P141A01,   P324P05,   P071M13,   P168H13

 Non-Plausible BAC matches

P326H01,   P126O23,   P276B18

 Overgo Sequences

A sequence
ATACCTGATTCCAAGCATCGCATC
B sequence
GTTATTAGGAGCCCGAGATGCGAT
AB sequence
ATACCTGATTCCAAGCATCGCATCTCGGGC
Marker sequence
CCTCTCCCATTTTGCGCATATAATACCTGATTCCAAGCATCGCATCTCGG
GCTCCTAATAACCCTTTAACAATATCTGCTTGACTTGGTTCATTTGCTCT
CTCAAGCCACTATTCATGGTGAAAACCAGAAAAAACTTCAGTTCTAGAAG
AAAATTTCATTAACTGTGGAAGGAATATTACATCATCCAATCAAAAAGTA
ATGATGCTCGATTTGAAGACAGAAATATTTGCAAGGAGGTACTTGGATTG
TCTAAATAGTTGATCACGAAAAAGTCATTCAGACATGCAGGAGAAAAGAA
TTGAATGACCTTTTTTAGATCGTCGGTGCCTTGCCTCCAAAACGTGATGG
TACTAAAAAATAAAAAGGATTTTTGTTTGTGTAGAAACAACATAATGGAA
GCTTCTCTAAGAAAAATGGTTGTTGGTTCCAGCTAATGGTTGCCACAAGC
AATTTGAACGACTCGAAGGAGGAGGATTAAGACTCCCAACAGAAAGAGGG
CT
Genomic location of TG472  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D333 marker 333
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)