SGN Marker TG473

SGN-M334

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG473 image not available
Forward sequence
AATCAAGTCCAACCTTAGATGTTGTTTCATGACTAAAATTTCAAAGAGAAATTCGACAAGCTTCAAGAAACTTACGCTCCCACCAATGGT
GATGCCCCAGAGAAAATAAGGGGAAAATCAGGCCTCTCAAATCTGAAAAATTAAAGTAAGTCTGACAATTTCATCAAGCCACAATTAGCG
TGGCCATAACATCATCAAGCTTTTAAAAACTCACTCTCTAGGATCCAATTCAAGTAACTCCGCCACTGATTCTGACCATGCTACAAGCTG
AGGGTTATTGACCGGTACAGAGGGTAACACTTTCGTGTAGCAAGCATGCAACACCTACAAAGACAATGTTTGAACAGATGATGACTTGCA
AAAGAATTCTATCTTCAGTTACTGACATTTCAAACTCAATGCAAACTGCATTGCTTATCACATAGGTAACAACTATATTCCACATTTTTT
GCAATCAAGG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGGGTAGAGAGAAAAGATAGAACCTATAAATTAAAAATAGGGAAAAAAAAACATAATATACTTCTTCAA
GTAATAATTCAACCCATCAATTATCAAAAAAATGCTTTCCTCCCTTTCTCACACCTCTTCTTCCACCACCGCTTTCTTCCTCTCTTCCTC
CGCCAAATTTCTCCGACCCAGATTCTCTTCTTGTCCTTTCCAGTTCCCAATTCATCAAAAACGACACCGTTCTCTGTTTTCTCATAGCAC
AGCAGCTTCAATGGACTCGGCTGCCACCGTTGATTCAGTTGCTGATGATTTAAAGAAACAAAACTTAAAAGGAGTTGAAATTAAGCTTAA
ATTGAATCTCGAAGAGCTTAATTGGGATAACTCTTTTGTTCGTGAACTACCTGGCGACCCCAGAAGTGATAGTATTCCAAGAGAGGTTTG
TGTTCTAATTTCTCAAAGATTGAATCTTTATTTGATTGAATGTAAAAGGTGTTTCTTTTTATTGGGGATATTACTCTTTATGGGGTTACA
GTAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1550793.2e-0540 (8.7% of RFLP seq)+
SGN-U1550793.4e-0845 (9.8% of RFLP seq)+
SGN-U1665281.7e-2558 (12.6% of RFLP seq)+
SGN-U1665289.9e-58112 (24.3% of RFLP seq)+
SGN-U1550792.5e-0686 (15.8% of RFLP seq)-
SGN-U166528325 (59.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53559)
Chromosome
12
Position
77.91 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53334)
Chromosome
12
Position
6.65 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42471)
Chromosome
5
Position
123.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40057)
Chromosome
12
Position
117.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8911)
Chromosome
5
Position
118.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8910)
Chromosome
12
Position
91.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8914)
Chromosome
12
Position
105.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG473 was used as an overgo probe on plate 3 [well C9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTACAAGCTGAGGGTTATTGACCG
B sequence
GTGTTACCCTCTGTACCGGTCAAT
AB sequence
CTACAAGCTGAGGGTTATTGACCGGTACAG
Marker sequence
AAAATCAGGCCTCTCAAATCTGAAAAATTAAAGTAAGTCTGACAATTTCA
TCAAGCCACAATTAGCGTGGCCATAACATCATCAAGCTTTTAAAAACTCA
CTCTCTAGGATCCAATTCAAGTAACTCCGCCACTGATTCTGACCATGCTA
CAAGCTGAGGGTTATTGACCGGTACAGAGGGTAACACTTTCGTGTAGCAA
GCATGCAACACCTACAAAGACAATGTTTGAACAGATGATGACTTGCAAAA
GAATTCTATCTTCAGTTACTGACATTTCAAACTCAATGCAAACTGCATTG
CTTATCACATAGGTAACAACTATATTCCACATTTTTTGCAATCAAGG
Genomic location of TG473  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D334 marker 334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)