SGN Marker CT24

SGN-M336

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT24 image not available
Forward sequence
CTTTTTTTTTTTTTTTTAACGACGAGAGTCAATTGAGGATTAACAAAATATAAGAGTACAGGTCTTTGGATGGACCTTATTTTTTACAAC
TATAATATACATCACAGCGACCCAACTCCTCACAATTAAGTCACAACGCTGAGTCTATATCATGCATCTTCCTGCAACAACGTCCTTCAC
CTTTGAATTACCATGGCTAAAACTCAAAAGTGTACCTTTTTATCTTATGTGGAAGAAAGACCAAAAGCTAACTTATCTAATGACATATCT
GGGCTAAACATTTTGTGAGCTTACTATTGTATAATAAGATAGCTCACCTCCGAGTATTTTCTAAAGAATTAACAAACTTTTCCCTTGGGG
ATCAGTAGCAGTGGTTGAAACAGAAGAAGAAACCTCTTGGCTGATTCTCCATGGGCGTTTTAGGGGGCTCAACCGAGTCATCACGCTTGG
ACATTAA
Reverse sequence
TTTTCTTTTTTTTCTCTCTTCAGTTTCCCCTCCGGAACCAGTAATACCAGCTAGGATTTTCACTTCAGAGAATCATGTATTACCACCGGA
GTCTCCAGGTACCAGCTCGTTAATGTCCAAGCGTGATGACTCGGTTGAGACCCCTAAAACACCCATGGAGAATCAGCCAAGAGGTTTCTT
CTTCTGTTTTAACCAATGCTACTGATCCCCAAGGGAAAAGTTTGTTAATTCTCTAGAAAATACTCGGAGTTGAGCTATCTTATTATACAA
TAGTAAGCTCACAAAATGTTTAGCCCAGATATGTCACTAGATAACTTAGCTTTTGGTCTTTCTTCCACATAAGATAAAAAGGTACACTTT
TGAGTTTTAGCCATGGTAATTCAAAGGTGAAGGACGTTGTTGCAGGAAGATGCATGATCTAGACTCGCGTTCTGACTTAATTGTGAGGAG
TTGGGTTGCTGTGATGTATATTATAGTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1715123.4e-82177 (38.7% of RFLP seq)+
SGN-U1715129e-154273 (57.1% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42962)
Chromosome
2
Position
68.60 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43962
Forward primer (5'-3')
ACCAGCTAGGATTTTCACTTCAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ACATCACAGCAACCCAACTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42334)
Chromosome
2
Position
104.80 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39030)
Chromosome
2
Position
139.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8920)
Chromosome
2
Position
99.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8919)
Chromosome
2
Position
123.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT24 was used as an overgo probe on plate 6 [well A9]

Plausible BAC Matches:   P061B22,   P021H15,   P125D06,   P038O16,   P143J24,   P302K23,   P137B23,   P028F18,   P048B13,   P064B17,   P315L08,   P323J18

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACAACGCTGAGTCTATATCATGC
B sequence
GTTGTTGCAGGAAGATGCATGATA
AB sequence
CACAACGCTGAGTCTATATCATGCATCTTC
Marker sequence
CTTTTTTTTTTTTTTTTAACGACGAGAGTCAATTGAGGATTAACAAAATA
TAAGAGTACAGGTCTTTGGATGGACCTTATTTTTTACAACTATAATATAC
ATCACAGCGACCCAACTCCTCACAATTAAGTCACAACGCTGAGTCTATAT
CATGCATCTTCCTGCAACAACGTCCTTCACCTTTGAATTACCATGGCTAA
AACTCAAAAGTGTACCTTTTTATCTTATGTGGAAGAAAGACCAAAAGCTA
ACTTATCTAATGACATATCTGGGCTAAACATTTTGTGAGCTTACTATTGT
ATAATAAGATAGCTCACCTCCGAGTATTTTCTAAAGAATTAACAAACTTT
TCCCTTGGGGATCAGTAGCAGTGGTTGAAACAGAAGAAGAAACCTCTTGG
CTGATTCTCCATGGGCGTTTTAGGGGGCTCAACCGAGTCATCACGCTTGG
ACATTAA
Genomic location of CT24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D336 marker 336
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)