SGN Marker ovate

SGN-M3455
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the ovate locus.

Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42507)
Chromosome
2
Position
79.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41612)
Chromosome
2
Position
101.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43580
Forward primer (5'-3')
ACAAGAGAAACGGCAACACC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GGATCCTGCGATTTCTTCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40904)
Chromosome
2
Position
73.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36594
Forward primer (5'-3')
CACGACGTTGTAAAACGACAATGCTTTCCGTTCAACGAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CGTCGGTTTCTACGTCATCA
Digested band sizes (using DdeI)
Solanum pennellii TA56
125
Solanum lycopersicum TA209
138
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39126)
Chromosome
2
Position
89.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 13423)
Chromosome
2
Position
74.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-LXM 2002
Other PCR data 
PCR data   Exp. ID 35585
Forward primer (5'-3')
GATAGTGAAGAAATCTCAGGACCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGTGGAGTTAGAAGTCCCATGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 560
Solanum pennellii LA716: 580
Approximate temperature
55°C
  
Genomic location of ovate  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3455 marker 3455
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)