SGN Marker TG480

SGN-M352

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG480 image not available
Forward sequence
TGGAAGTGAGAGATTTCATTGGCGGAGATAGAGAACGGCGACGGCAGCATCTAATCTGTGCCCGGCGAAGTAGATTAGGTTAGAATTAGG
ATTATAGAATTAGTACTATTAGTTAGAAAAAGATTCGTGAATACTGTACGTCTTTGAAAACAGTGCCCCTTGAGAAAATGAATATCTTAT
GGGTCCTGTTTGGCGCTTTTCATTTTCGAGAGCGGGTCCACTGCCAAACACACTACCAACTTCGTTCATTTCATTTATTAGTTACATGCA
TAAATACAAACGTTATTTTACAAACCAGTATCAACATACCCACCCAGCAGCAGTGTAATCCCATCACGTTTATGTTTGCCAAACAAAAGA
ATAAAATTATTCCTATCTAACAGAAGACATGATGTCCACATATAAATTGGGTCCAACAGTACCAGATCCATCTCTCCATTTATGCAATGG
CAATTTGGCAACGGCCACAAATATGTTAGGCTTGAGGGATGCTTGTGAAGCT
Reverse sequence
GGGAGACAGCTTGCATGCCTGCAGAAAAATTAAAATACTGGCAGGTGAGTGCACAGTGGTTTCTTTGATGCAAAGGTCTATGTAATATTA
ATTGAATTGAAGTAAATGAAAAGATAGTAATAGAAGACCAACTGTGTGGAACTACTTTGATGAGGTTTAAAAAACTAGGTCCAAAGTTAA
AACAATTGAGGGGATGAACTGGAAAGGTTTATTTATAGCATCCAAGTGTGTTGCTAACAATGGTTTTTCACTGCTACAGTTGCAACAGCG
GTTAAATGCCATGTCAAGTTGCGGAGAGGATGGGGACAGAAGAGAGTTGGAATCCTGATGACAATGATACGTTTCATATATAAACACCGT
GTATATTCAGGTGTCTATTTGATGTTGCTAGAGCAGATAATTATGATTTTTTTCACACACATATAAATGCCTTGAACAGACGTAATTGTC
GTTTGCTTTTGCAGGTTTAAGTATAGGAAGAGGCAGAGTGTAATTATTCTTATGTCACTGAATCATGCACTTGTCCTTGTTGAATAGCTC
GTGTGGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1461023.8e-4896 (19.1% of RFLP seq)+
SGN-U1481791.3e-72137 (27.3% of RFLP seq)+
SGN-U1461022.5e-0626 (4.8% of RFLP seq)-
SGN-U1461023.9e-4286 (15.7% of RFLP seq)-
SGN-U1461024.9e-60116 (21.2% of RFLP seq)-
SGN-U161741381 (69.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 8953)
Chromosome
8
Position
79.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8954)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG480 was used as an overgo probe on plate 15 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATGGGTCCTGTTTGGCGCTTTTC
B sequence
ACCCGCTCTCGAAAATGAAAAGCG
AB sequence
TATGGGTCCTGTTTGGCGCTTTTCATTTTC
Marker sequence
TGGAAGTGAGAGATTTCATTGGCGGAGATAGAGAACGGCGACGGCAGCAT
CTAATCTGTGCCCGGCGAAGTAGATTAGGTTAGAATTAGGATTATAGAAT
TAGTACTATTAGTTAGAAAAAGATTCGTGAATACTGTACGTCTTTGAAAA
CAGTGCCCCTTGAGAAAATGAATATCTTATGGGTCCTGTTTGGCGCTTTT
CATTTTCGAGAGCGGGTCCACTGCCAAACACACTACCAACTTCGTTCATT
TCATTTATTAGTTACATGCATAAATACAAACGTTATTTTACAAACCAGTA
TCAACATACCCACCCAGCAGCAGTGTAATCCCATCACGTTTATGTTTGCC
AAACAAAAGAATAAAATTATTCCTATCTAACAGAAGACATGATGTCCACA
TATAAATTGGGTCCAACAGTACCAGATCCATCTCTCCATTTATGCAATGG
CAATTTGGCAACGGCCACAAATATGTTAGGCTTGAGGGATGCTTGTGAAG
CT
Genomic location of TG480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D352 marker 352
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)