SGN Marker TG37

SGN-M359

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2900
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCCATCCGCCATGGAGGAAGCCTGAAATCATCAATTGAGAAGACAGCCTTCGATTCTGGAGAAGATACCAATTATCAACGAGGGGCAGAA
GGAGCACTGGAGGATTTCCTGCCAACTGGATATATAACCTGTCACATTACTAAAGTTAATCGAAAGAGAACCGAGAAAGGAAGAAAAAAT
GACAAGCCAAAAGATGATTAGACAAACAAATTACTCATTTAGTCTCAATGATAAATACAAGCTGAAGAAACAATTAAACCAACAAATGAA
CTATTTAACCTCCACAAAAAGTTTCAGTTTTAACACTTAAATGATGCAGCTTTACGAATGATATGAAAGCAAGTAAATGACAAAAAAAAT
GTATTGCATTCATGTCATCCAAATTTTCCCCAGAAGATATGCAAAAATAATGCTTCAGATGATCCTCAAATGATGCCATGCTTAAATCTC
CTTCAATAGTAAATGACAAAAAAGATGTATTGCATTCATTCATCCTAATTTTCCCCCAGAGTTACGCAAAAATAATGCCTCAAATGATGC
GATGC
Reverse sequence
AACTTACATTCCATCCAACCATGGAGGAAGCCTGAAATCATCAATTGAGAAGACAGCCTTCAATTCAGGAGAAGATACCAATTTCAAACG
TGGGGCAGAAGGAGCACTGGAGTATTTCCTGCCAACTGGATATATAACCTGTCACATTAGTAAAGTTAATCAAAAGAGAACCGAGAAAGG
AAGAAAAAATGACAAGCCAAAAGATGATTAGACAAACAAATTACTCATTTAGTCTCAATGATAAATACAAGCTGAAGAAACAATTAAACC
AACAAATGAACTATTTAACCTCCACAAAAAGTTTCAGTTTTAACACTTAAATGATGCAGCTTTAGGAATGATATGAAAGCAAGTAAATGA
CAAAAAAAATGTATTGCATTCATTCATCCAAATTTTCCCCAGAAGATATGCAAAAATAATGCTTCAAATGATCCTCAAATGATGCCATGC
TTAAATCTCCTTCAATAGTAAATGACAAAAAAGATGTATTGCATTCATTCATCCTAATTTTCCCCCAGAGTTACGCAAAAATAATGCCTC
AAATGATGCGATGCTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53288)
Chromosome
4
Position
76.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Potato-TXB 1992   
Map version
27 (location: 8973)
Chromosome
4
Position
63.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Genomic location of TG37  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D359 marker 359
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)