SGN Marker TG559

SGN-M361

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG559 image not available
Forward sequence
GGAGACAGCTTGCATGCCTGCAGTTCATAAAGTTTGGTTTTGATACACTTGCACCAAATGCTCTGTTATTCAGCTTAATTTATCCGGAAG
AGTCATGTTTATCTATAGATCTGAGACATCGGCTTCCAAGAGGAGGGAGGCACTACATGTATCTTTATGCTGTTTGATTTTTTTGTGAAA
CAGTTCTGTATGCAAACTTGTCAAGAACACCCTACGCTTCTACCAAGTCAAAGAAGTGACGAGCAAACAAAACAAGCATATAAGATGTTA
TCCGATTGCTTTATGTTGTAAGATAATTATTAATTGAACCACTTCAATTAGCACTTTGGTTTCCATCTTAT
Reverse sequence
TTTTCCTGGGAGACAATCTTATCATAAGGCAGTCCCTGTCCCAATAAAATCATCTATTGTCTTTTTGCTTTGTCCCACAACCCTTGACCT
ACTTCTTAAATTAAAAGTGGTATACTGGAATAAATGCACAGGTGATTGAATAGTTCTCTGAAAAAGAAAATTGGCACTTCAGAGATGAGC
AAAATAAAACACGGCCTTGGTAAGTGTAGAGTAACATGTAGCAGGAGGACAGCTGCTCAACAAGTTGAGCCTAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53568)
Chromosome
2
Position
75.89 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53567)
Chromosome
1
Position
82.14 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8975)
Chromosome
1
Position
81.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG559 was used as an overgo probe on plate 15 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTGAGACATCGGCTTCCAAGAG
B sequence
ATGTAGTGCCTCCCTCCTCTTGGA
AB sequence
ATCTGAGACATCGGCTTCCAAGAGGAGGGA
Marker sequence
GGAGACAGCTTGCATGCCTGCAGTTCATAAAGTTTGGTTTTGATACACTT
GCACCAAATGCTCTGTTATTCAGCTTAATTTATCCGGAAGAGTCATGTTT
ATCTATAGATCTGAGACATCGGCTTCCAAGAGGAGGGAGGCACTACATGT
ATCTTTATGCTGTTTGATTTTTTTGTGAAACAGTTCTGTATGCAAACTTG
TCAAGAACACCCTACGCTTCTACCAAGTCAAAGAAGTGACGAGCAAACAA
AACAAGCATATAAGATGTTATCCGATTGCTTTATGTTGTAAGATAATTAT
TAATTGAACCACTTCAATTAGCACTTTGGTTTCCATCTTAT
Genomic location of TG559  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D361 marker 361
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)