SGN Marker TG126

SGN-M368

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACACTTACTTAATATCTCTATATGTAATGATAGTGTAGAGAATCCTTACCTTGTTAGGTATATAGAATTAAACCTTTTGTAAATCCCAGT
TTCTGGTCACTCACTGTGCAGTGAATTGAGGGACTTCCTTCAAGGCGGCTTCTTTGTTTTGTTTTGCTAGGAAGTGTGATTTTGCGCTTG
AATTTACATCTGTGCCAGCTTAACTTGTCCTTACATATCATAAAAATGCAAAGGTGTCACACGAGGATCAATTAAAAATGATAATATGTG
AATGTTAATGCAGGCAAAAGAAATTATGTGGTGAGGAAGACTGTAAGCGATGTGGTGATTCAGACATGGATCAACCTTGCATAGGTTAGT
CTTACAAATTGTTTATTGTTTTGTGGTACTTACTAGTCTGTAAACAGAGTGATGAATATAAAATTTCATATACAGGCAAGACAG
Reverse sequence
GAGTGACGGAAATGCCACTTTCATAGATTGGAACGCTGACCCAACGCTTCCTGATAAAGGCGCTCCTTTATGTCATCAGACTCCTCTTCA
AAAGGCACAATCTCCATCAAAAATCAATACATAAAGAAACACAGACATTTTCATACAGCAAAATAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39898)
Chromosome
3
Position
139.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8987)
Chromosome
2
Position
99.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG126 was used as an overgo probe on plate 6 [well A7]

Plausible BAC Matches:   P203H10,   P172P05,   P077E16,   P164B16,   P297F23,   P231J18

 Overgo Sequences

A sequence
ATCCCAGTTTCTGGTCACTCACTG
B sequence
CCCTCAATTCACTGCACAGTGAGT
AB sequence
ATCCCAGTTTCTGGTCACTCACTGTGCAGT
Marker sequence
ACACTTACTTAATATCTCTATATGTAATGATAGTGTAGAGAATCCTTACC
TTGTTAGGTATATAGAATTAAACCTTTTGTAAATCCCAGTTTCTGGTCAC
TCACTGTGCAGTGAATTGAGGGACTTCCTTCAAGGCGGCTTCTTTGTTTT
GTTTTGCTAGGAAGTGTGATTTTGCGCTTGAATTTACATCTGTGCCAGCT
TAACTTGTCCTTACATATCATAAAAATGCAAAGGTGTCACACGAGGATCA
ATTAAAAATGATAATATGTGAATGTTAATGCAGGCAAAAGAAATTATGTG
GTGAGGAAGACTGTAAGCGATGTGGTGATTCAGACATGGATCAACCTTGC
ATAGGTTAGTCTTACAAATTGTTTATTGTTTTGTGGTACTTACTAGTCTG
TAAACAGAGTGATGAATATAAAATTTCATATACAGGCAAGACAG
Genomic location of TG126  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D368 marker 368
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)