SGN Marker TG127

SGN-M369

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG127 image not available
Forward sequence
TACCTTTTTGAGGATTCTCTANCCGACCCTACTTNCTTGGGATTGAAGCGTAGCTGTTGTCTATATACATTAGTATTTACTTTAACATGT
TGTAAAACACAAGGTGATTTTTTCCATCTGTCTTAGCCTTGGTGGACAGAGTTACTTGGTACTTGTTATTGATGGGAAGTGGCAGGTATC
CCGTGGAATTAGTCGAGGTGAGCAAAAGCTAGCCCGGACACCACGATCATCAAAATAAAAAAAGTTTGTTACCTATAGCTATCTTTTAGG
TGACCTGATTGTGTATTATGTATGACAAGTCTTACTTAGTTGGCGTTTGAACACCGTTTTCTGCTTCTATAAAGCTTGAGATACTGGTTA
ATTTAGTTCAAGAAGGTTTTAGACTTGTATTCGTTTTGTTTAGACTTGTTGAATAAATGTTACTCGAAAAGTTATAGGCTAA
Reverse sequence
CAACGACGATGATAATACTTAGATACCTCTAGCTAGTAAAATGTAGCACATGATCAAAACCTGAGAAGATTGAATAGTTTGTTTCAGTTT
TAGTCGAAAGATACGTACTTGATTCCCACAATAACCTTGAAATCATCTTCCAAGGATCTTTTTATGTACTTCTGAAAATTAAACTTACTT
CCAGGTGCTAAATGGACCTGCAACAAGAGGAAAACAATAAACAAAAAGAAGTAAATATCTTTTTCTGTCCTACAAGAGACATAATTTGAT
TTGAAGCCTTCAATTTGTGAACCTCACCGAGATGAAACCGTGGCGCATGGTCAAGTAGTCAGCTTTCCTAACTGACCTGAAAAATTGCCT
AAAAAAGCACACCTGGATATTTTGGGGAACTAGTTAGAAAAGAAGAAACAAAAATGGTTGTAATACAACATTTCACTTGTTACATTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1694855e-0755 (12.4% of RFLP seq)+
SGN-U1546937.4e-3789 (19.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53168)
Chromosome
8
Position
82.25 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8989)
Chromosome
8
Position
28.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8990)
Chromosome
8
Position
11.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG127 was used as an overgo probe on plate 13 [well E6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATTGATGGGAAGTGGCAGGTATCC
B sequence
CTCGACTAATTCCACGGGATACCT
AB sequence
ATTGATGGGAAGTGGCAGGTATCCCGTGGA
Marker sequence
TACCTTTTTGAGGATTCTCTANCCGACCCTACTTNCTTGGGATTGAAGCG
TAGCTGTTGTCTATATACATTAGTATTTACTTTAACATGTTGTAAAACAC
AAGGTGATTTTTTCCATCTGTCTTAGCCTTGGTGGACAGAGTTACTTGGT
ACTTGTTATTGATGGGAAGTGGCAGGTATCCCGTGGAATTAGTCGAGGTG
AGCAAAAGCTAGCCCGGACACCACGATCATCAAAATAAAAAAAGTTTGTT
ACCTATAGCTATCTTTTAGGTGACCTGATTGTGTATTATGTATGACAAGT
CTTACTTAGTTGGCGTTTGAACACCGTTTTCTGCTTCTATAAAGCTTGAG
ATACTGGTTAATTTAGTTCAAGAAGGTTTTAGACTTGTATTCGTTTTGTT
TAGACTTGTTGAATAAATGTTACTCGAAAAGTTATAGGCTAA
Genomic location of TG127  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D369 marker 369
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)