SGN Marker Cf9

SGN-M3775

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51913)
Chromosome
1
Position
33.41 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39087)
Chromosome
1
Position
17.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35572
Forward primer (5'-3')
CGAGTTTGCTTGCTTTAGGG
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 1116
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACGGACAACCTGTGTTA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1116
Solanum lycopersicum LA925: 1116
Approximate temperature
60°C
  
Genomic location of Cf9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3775 marker 3775
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)