SGN Marker CT42

SGN-M378

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT42 image not available
Forward sequence
CGTTTGCAGCAGTTTAGAAAGTCTTCAAGTTTTAGTTTCATGTAACCTTTGTATAGAGCAAGGTAGGTGTCACTCTTGTATCTAGCCTTG
TTCATAGTCTGATATCCTTTCTTTAGCTTAACTTCATGTAAACAACAAAACTGTAAAAGACCAAAAAATTGTAAAAATCAGTTGAACAAA
AGTGAAAAAAAGAGCAACTTTCAAGTTTCATTTCTCCATTAAACAACGCTCTGAGTTAAGGTCAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTGACCTTAACTCAAAGCGTTGTTTAATGGAGAAATGAAACTTGAAAGTTGCTCTTTTTTTCACTTTT
GTTCAACTGATTTTTACAATTTTTTGGGCTTTTACAGTTTTGTTGTTTACATGAAGTTAAGCTAAAGAAAGGATATCAGACTATGAACAA
GGCTAGATACAAGAGTGACACCTACCTTGCTCTATACAAAGGGTACATGAAACTAAAACTTGAAGACTTTCTAAACTGCTGCAAACG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1442304.5e-0953 (20.9% of RFLP seq)+
SGN-U1442314.5e-0953 (20.9% of RFLP seq)+
SGN-U1440091.1e-0931 (12.3% of RFLP seq)+
SGN-U1440082.9e-1032 (12.6% of RFLP seq)+
SGN-U1609048.2e-2052 (20.6% of RFLP seq)+
SGN-U1609041.7e-42126 (49.8% of RFLP seq)+
SGN-U1440091.4e-64127 (50.2% of RFLP seq)+
SGN-U1440081.5e-67128 (50.6% of RFLP seq)+
SGN-U1442304.8e-0953 (19.9% of RFLP seq)-
SGN-U1442314.8e-0953 (19.9% of RFLP seq)-
SGN-U1440081.2e-0931 (11.6% of RFLP seq)-
SGN-U1440091.2e-0931 (11.6% of RFLP seq)-
SGN-U1609041.4e-2151 (19.1% of RFLP seq)-
SGN-U1609044.5e-40126 (47.2% of RFLP seq)-
SGN-U1440093.7e-62127 (47.6% of RFLP seq)-
SGN-U1440083.9e-65128 (47.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39052)
Chromosome
10
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9013)
Chromosome
10
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT42 was used as an overgo probe on plate 5 [well G11]

Plausible BAC Matches:   P109B01,   P031N18,   P222I17,   P035L03,   P306J24,   P038B17,   P127I16,   P196A17,   P304P23,   P333L23,   P300M17,   P158J01,   P313M08,   P029N19,   P039A10,   P181E06,   P134K12,   P313O21,   P222A18,   P169J16,   P201F04,   P106K16,   P090C16,   P135A21,   P313H24,   P175C03,   P067I10,   P066L24,   P320E22,   P335M21,   P024B09,   P173A16,   P158D01,   P223K01,   P257J02,   P106H13,   P038M13,   P108B17,   P150P23,   P236K12,   P118D22,   P169I12,   P022H21,   P289A06,   P135K15,   P069I12,   P117F20,   P122L18,   P313M06,   P214J02,   P313B08,   P316J24,   P285C17,   P208E05,   P251B02,   P017H12,   P230D07,   P070D01,   P214G13,   P233H14,   P165O04,   P063F16,   P056K17,   P136H06,   P302B08,   P163F03,   P090F06,   P145P14,   P157E24,   P033C18,   P214K18,   P328K17,   P171F13,   P312K20

 Overgo Sequences

A sequence
AGAGCAAGGTAGGTGTCACTCTTG
B sequence
TGAACAAGGCTAGATACAAGAGTG
AB sequence
AGAGCAAGGTAGGTGTCACTCTTGTATCTA
Marker sequence
CGTTTGCAGCAGTTTAGAAAGTCTTCAAGTTTTAGTTTCATGTAACCTTT
GTATAGAGCAAGGTAGGTGTCACTCTTGTATCTAGCCTTGTTCATAGTCT
GATATCCTTTCTTTAGCTTAACTTCATGTAAACAACAAAACTGTAAAAGA
CCAAAAAATTGTAAAAATCAGTTGAACAAAAGTGAAAAAAAGAGCAACTT
TCAAGTTTCATTTCTCCATTAAACAACGCTCTGAGTTAAGGTCAAAAAAA
AAA
Genomic location of CT42  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D378 marker 378
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)