SGN Marker C2_At4g15520

SGN-M3786
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300792 (SGN)
121467 (CGN)
---
Lycopersicon CombinedSingleSGN-U224862---
Solanum tuberosumSingleSGN-U245444---
ArabidopsisSingleAt4g15520 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46717)
Chromosome
9
Position
44.30 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38641)
Chromosome
1
Position
47.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39825
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
370+450
Solanum pennellii TA56
280
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26694)
Chromosome
4
Position
8.86 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11409
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11410
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11411
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13415
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 13416
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13417
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 720+900
Approximate temperature
55°C
  
PCR data   Exp. ID 13418
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13419
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13420
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350+450
Approximate temperature
55°C
  
PCR data   Exp. ID 13421
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13422
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13423
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32641
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33094
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33095
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33096
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 720+900
Approximate temperature
55°C
  
PCR data   Exp. ID 33097
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11412
Forward primer (5'-3')
TCCGTTTCCGCCACTTCCAC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 370+450
Solanum pennellii LA716: 280
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAATGAAGCAGTACCACACCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
C2_At4g15520 was used as an overgo probe on plate 12 [well H11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTTGGGCTGGATTCTCCGAGAGAA
B sequence
TTGTTCCCTTCACGTGTTCTCTCG
AB sequence
TTTGGGCTGGATTCTCCGAGAGAACACGTG
Marker sequence
ATGGAAAATGAGAAGAAACTAGAGAGCTTCGTGCTGGTACATAATATAGC
AAAGAGACACAACGTCGGAACCTTAGCTCGTAGCGCCACGGCGTTCGGCG
TCTCGGAGATGATACTCGTCGGCCGTAGAGATTTCAACGCTTTCGGTAGC
CACGGCTCCACTTCTCACGTCCGTTTCCGCCACTTCCACTCCCTTGCCGA
TGCTAAAACCTTCCTCAAGGNNNNNAAAGAGATTGTGATATATGTGGAGT
TGAAATTACAGAAAATGCGGTTGCTGTAAATGAACATCCTTTTAAGAGAA
GTACTGCTTTCCTGCTGGGCAATGAGGNNNNNGTACTGGACTTTCTGCAA
AAGAGTGTGAGATATGTGATTTCTTTGTATATATTCCACAATATGGGTGT
GGTACTGCTTCATTGAATGTGACTGTTGCTGCTTCCATTGTTCTACATCA
ATTTGGAGNNNNNTTTGGGCTGGATTCTCCGAGAGAACACGTGAAGGGAA
CAAGTTCATTGTGGCTGAAAGACATTTCAAACAGGCAAAGAAAAATTACT
GCATGGAATCATCTGAATCTGTTGCTGAGGAGCGAAGACTGAAGAGGGAA
AATCTTTCAAATGGGTTCTTTGAAGATGCTGGAAAAGAGGAATCTCCTTC
AAATCTTTTAGATACCTTGTTCGATGACTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g15520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3786 marker 3786
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)