SGN Marker TG494

SGN-M381

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG494 image not available
Forward sequence
CGAACCAAGATTAGACATAGAAAACAAGCTCATGTGCATGAGAGTTAGAGATTTGAGGCCGGTTTAGCTTTACTTTAAACCTATGCTTTC
TCTTTTTTTGATCATGTTCCTATTCTCTAGTCTACCTTTTCCTATTATTTGTTCCCAGGAGTAGTTATGGTTTGACTGAAGCCTGAAGGA
AGGCATAGGTTGCAACCCTTTATTTCATAAAGATAGCCTCAATGTTTTCACCTCTTACAAACTAAAGCACCGATTGTGTAAAACCTCATT
TCCCTGCTTGGACCTCCCCGTAGACAAGCTAAGAGTGTCTCATTTGGTTAACCAGTTTGCAAAGCTTAATAATGGAGCTAGGACACTGTT
ATACTTTGGATGATAAAAGGTTGACCAGCATAGGGAGAAAGAAACAGGTACATAAAGCCTTACCACAAAGCATCTAATGAGGAAACAGGT
GAAAC
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTTCCCTTTCTATATTAACCATCTGAAATAACATAGAGAGATTCTGTAAGTTCCTCTGTATATTTTTT
AATAAGGTCCTCTGTTTCTTCTTTATTCCCTGCATTGTCATCTTTGTACTGCCTCTACCAGGCATCATCCAAACAATCCCAAACCGGTTT
AGAAATATACACCAAGTTATCCATATGAATTTGCAACGTAGGAGTAACTGTCCAAATGATTTAAAGCCCTCTTTGCAGTAGTAGTATCTG
CTGGAGAAGTGAAATCTTCCTCTGTGCTGGCTATCATATGTTACTATGTTTCATTCAAGGCTAATACCCAAAAAACAGCCACTTTGGGAG
TAGCTCTGGTCCTCCAAGTCATCTTCCATGACTATTAGAGCCAATATTACCACATTCTTCCTTAACAACTAACTGTATCATGCTTTAGGT
GAGAAGTTCGCATCATCCAATGATCCATTTCCATCACTCCCCCTAATTTAACAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9021)
Chromosome
2
Position
64.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG494 was used as an overgo probe on plate 6 [well B5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTTTGACTGAAGCCTGAAGGAAGG
B sequence
AGGGTTGCAACCTATGCCTTCCTT
AB sequence
GTTTGACTGAAGCCTGAAGGAAGGCATAGG
Marker sequence
CGAACCAAGATTAGACATAGAAAACAAGCTCATGTGCATGAGAGTTAGAG
ATTTGAGGCCGGTTTAGCTTTACTTTAAACCTATGCTTTCTCTTTTTTTG
ATCATGTTCCTATTCTCTAGTCTACCTTTTCCTATTATTTGTTCCCAGGA
GTAGTTATGGTTTGACTGAAGCCTGAAGGAAGGCATAGGTTGCAACCCTT
TATTTCATAAAGATAGCCTCAATGTTTTCACCTCTTACAAACTAAAGCAC
CGATTGTGTAAAACCTCATTTCCCTGCTTGGACCTCCCCGTAGACAAGCT
AAGAGTGTCTCATTTGGTTAACCAGTTTGCAAAGCTTAATAATGGAGCTA
GGACACTGTTATACTTTGGATGATAAAAGGTTGACCAGCATAGGGAGAAA
GAAACAGGTACATAAAGCCTTACCACAAAGCATCTAATGAGGAAACAGGT
GAAAC
Genomic location of TG494  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D381 marker 381
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)