Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker CT100

SGN-M383

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTGAACGAATGTCAAAGTTGTTAAGATAACAAAAGGGCAAACATGAAAATTTCAACCACAACAACGACAAAATAAG
TACCCAACAAAACTTTTATTGGTACAAAAGAATAAAAAATTCTACTCATTTGATTCATTAAAATCTTGAACTCTTGCATTCAACGCAAAA
GCCTTGAGGAAACCTCTTAGAATCAGCACAGTAATTGTAAACCATGTGTTTGGTCTGCACCCATAGTAGACTATTCCGTCCCTTACCATC
AAGATCATGTGTCTGCCATGGCTTCACGTTGTTTGTTGAACCGATAGACTTACGTGTAGAGGCACCTGATGATACTGCACAACCATCAAT
GTTAATGTTTCTGTAATAAGCACCGAATGGTGCAAGTGCCCAATCTGTTTTCACTCTGCCTCCTTGGGTTGCCCATTCATCTGCATTCCA
TAAACTGCAGTATACTTTCATTGCTTGACTCTAAGGGAAATGGA
Reverse sequence
TTTTTTTTTTTTTTTTCTTTAACAATTTCATCATCTTAGAAAATTATGGCTTCTAAATTTGCATCAACATTGCTTCTTCTGATTTCAGGA
CTAATGAGTATCCAATTACTAGCCTCAGCTGGAAGTTTCTATAGAGATGTAAACATAACTTGGGGCGAAGGACGCGGTAAAATACAAGAA
GGCGGTAGAGGCCTTGCCCTATCGCTTGATAAACTTTCTGGCTCTGGCTTTCAATCCAAAAATGAGTACCTTTTTGGAAGATTCGATATG
CAACTTAAACTCGTCCCTAAAAACTCTGCTGGCACTGTAACAACTTTCTTCTTATCTTCACAAGGAGAAGGACATGATGAGATCGATTTC
GAGTTCTTAGGCAATGTCTCTGGCCAGCCTTACACTATCCATACCAATGTATACACACAAGGAAAAGGAAACAAAGAACAACAATTTCAT
CTTTGGTTTGATCCAACTGCCGCGTTTCACACTTACACCATCGTCTGGAATCCTCATCGCATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1439828.8e-0665 (13.2% of RFLP seq)+
SGN-U1439839.1e-0958 (11.7% of RFLP seq)+
SGN-U1479981.6e-16103 (20.9% of RFLP seq)+
SGN-U1479986.8e-22128 (25.9% of RFLP seq)+
SGN-U146540370 (74.9% of RFLP seq)+
SGN-U1596313.6e-05128 (25.0% of RFLP seq)-
SGN-U1608893.6e-0556 (10.9% of RFLP seq)-
SGN-U1462109.2e-0625 (4.9% of RFLP seq)-
SGN-U1506151.5e-0792 (17.9% of RFLP seq)-
SGN-U1562461.5e-1065 (12.7% of RFLP seq)-
SGN-U1439832.5e-12212 (41.3% of RFLP seq)-
SGN-U1668452.5e-1292 (17.9% of RFLP seq)-
SGN-U1457171.6e-13122 (23.8% of RFLP seq)-
SGN-U1435934e-14251 (48.9% of RFLP seq)-
SGN-U1435944e-1483 (16.2% of RFLP seq)-
SGN-U1479984.7e-2683 (16.2% of RFLP seq)-
SGN-U1439823.1e-30282 (55.0% of RFLP seq)-
SGN-U1622403.6e-42178 (34.7% of RFLP seq)-
SGN-U1622393.6e-42178 (34.7% of RFLP seq)-
SGN-U1479993.1e-67272 (53.0% of RFLP seq)-
SGN-U146540497 (96.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53438)
Chromosome
12
Position
19.57 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51854)
Chromosome
12
Position
53.61 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42291)
Chromosome
10
Position
43.70 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9024)
Chromosome
10
Position
36.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9023)
Chromosome
12
Position
38.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9025)
Chromosome
12
Position
36.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT100 was used as an overgo probe on plate 6 [well A10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CATGTGTTTGGTCTGCACCCATAG
B sequence
GGGACGGAATAGTCTACTATGGGT
AB sequence
CATGTGTTTGGTCTGCACCCATAGTAGACT
Marker sequence
CTTTTTTTTTTTTTTTGAACGAATGTCAAAGTTGTTAAGATAACAAAAGG
GCAAACATGAAAATTTCAACCACAACAACGACAAAATAAGTACCCAACAA
AACTTTTATTGGTACAAAAGAATAAAAAATTCTACTCATTTGATTCATTA
AAATCTTGAACTCTTGCATTCAACGCAAAAGCCTTGAGGAAACCTCTTAG
AATCAGCACAGTAATTGTAAACCATGTGTTTGGTCTGCACCCATAGTAGA
CTATTCCGTCCCTTACCATCAAGATCATGTGTCTGCCATGGCTTCACGTT
GTTTGTTGAACCGATAGACTTACGTGTAGAGGCACCTGATGATACTGCAC
AACCATCAATGTTAATGTTTCTGTAATAAGCACCGAATGGTGCAAGTGCC
CAATCTGTTTTCACTCTGCCTCCTTGGGTTGCCCATTCATCTGCATTCCA
TAAACTGCAGTATACTTTCATTGCTTGACTCTAAGGGAAATGGA
Genomic location of CT100  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D383 marker 383
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)