SGN Marker CT101

SGN-M384

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CGGAATTCCTTTTTTTTTTTTTTTTTTTGAATATGAAATGCTGAAAAAAAATTCAACCTTGCGTGTTCTTGAACTAAACAATAATCTGAT
TGACTATTCTGGATTTTCAGGTCTTGCTGGATCACTTCTTGAGAATAAAACTTTACAATCCTTGCATCTCAACGGCAATTATGGTGGTGC
TTTAGGGGCTGCAGCACTGGCTAAAGGCTTGGAGAGCAATAAGTCCTTGAGGGAACTTTATTTGCAGGGGAACTCTGTTGGCGATGAAGG
AGTACGGGCATTAATCTCTGGCCTGTCTTTGCGTAAAGGGAAACTTGTCTTACTTGACCTTGCCAACAATTCAATTACTGCAAGAGGAGC
ATTTCATGTTGCCGAATACGTCAAAAAAAGCAAAAGCTTACTGTGGTTGAATCTCTATATGAATGACATTAAAGATGAGGGAGCTGAAAA
GATTGCAGAAGCTTTGAAGGAGAACCGCTCGATAACTAATGTTGATCTTG
Reverse sequence
TTTTTTTTTTTTTTTGAATATGAAATGGTGAATAGAAGTAATCTCTATATACTTGCCACTAATGTTTCAGAAACGGAATGTTATTTATCA
AAATTTCCACCGTCCCCCCGCTCAAAATGATTCAGTCACAAAGGGGAGCTGAGGTCGGACTCTTAGGAATATCATTGGTAAAAGAAAAAA
AAATACTCACCTATGCAGCCCTGCCCCAACCTCAAGAATGAAAGCAGGGAGAAAAATAAATCTGATCTAAGGAATGTGGTATTTTAAAAC
ATAACAGCAAGCTCCTTCTCAGTCATCTCAAATACATGGTCTCTTGCATCTGTGAGAGCTGTCTGTCCTAATTTGGTGAGGAAGTTACTG
GCAAGATTTAAAGATGTGAGTCTAACATCTTCATTTGCTTTAAGTGCTTGAGCGATAGAAAAAGCTCCTTCATCTCTAATTTCATTGAAC
CCTAAATTGAGTGTCATCAAAGATTCATTGACTACTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1622893.8e-48125 (25.0% of RFLP seq)+
SGN-U1488114.3e-57111 (22.2% of RFLP seq)+
SGN-U1622892e-105192 (38.4% of RFLP seq)+
SGN-U148208389 (77.8% of RFLP seq)+
SGN-U148811472 (96.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53439)
Chromosome
5
Position
5.32 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51855)
Chromosome
5
Position
14.43 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Pepper-COSII   
Map version
58 (location: 41572)
Chromosome
11
Position
55.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40735)
Chromosome
5
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38956)
Chromosome
5
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9026)
Chromosome
5
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Pepper-FAO3   
Map version
31 (location: 9030)
Chromosome
11
Position
41.51 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9027)
Chromosome
5
Position
0.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9033)
Chromosome
5
Position
7.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9032)
Chromosome
5
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT101 was used as an overgo probe on plate 1 [well A5]

Plausible BAC Matches:   P070N08,   P191B01

 Overgo Sequences

A sequence
ACTCTGTTGGCGATGAAGGAGTAC
B sequence
CCAGAGATTAATGCCCGTACTCCT
AB sequence
ACTCTGTTGGCGATGAAGGAGTACGGGCAT
Marker sequence
CGGAATTCCTTTTTTTTTTTTTTTTTTTGAATATGAAATGCTGAAAAAAA
ATTCAACCTTGCGTGTTCTTGAACTAAACAATAATCTGATTGACTATTCT
GGATTTTCAGGTCTTGCTGGATCACTTCTTGAGAATAAAACTTTACAATC
CTTGCATCTCAACGGCAATTATGGTGGTGCTTTAGGGGCTGCAGCACTGG
CTAAAGGCTTGGAGAGCAATAAGTCCTTGAGGGAACTTTATTTGCAGGGG
AACTCTGTTGGCGATGAAGGAGTACGGGCATTAATCTCTGGCCTGTCTTT
GCGTAAAGGGAAACTTGTCTTACTTGACCTTGCCAACAATTCAATTACTG
CAAGAGGAGCATTTCATGTTGCCGAATACGTCAAAAAAAGCAAAAGCTTA
CTGTGGTTGAATCTCTATATGAATGACATTAAAGATGAGGGAGCTGAAAA
GATTGCAGAAGCTTTGAAGGAGAACCGCTCGATAACTAATGTTGATCTTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT101  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D384 marker 384
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)